Transcript: Human NM_001146191.2

Homo sapiens myelin protein zero like 1 (MPZL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
MPZL1 (9019)
Length:
4528
CDS:
171..530

Additional Resources:

NCBI RefSeq record:
NM_001146191.2
NBCI Gene record:
MPZL1 (9019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117362 GCCCACAGTTATGGAAAGAAT pLKO.1 1933 3UTR 100% 5.625 3.938 N MPZL1 n/a
2 TRCN0000299474 GCCCACAGTTATGGAAAGAAT pLKO_005 1933 3UTR 100% 5.625 3.938 N MPZL1 n/a
3 TRCN0000117363 CCAGTCATATATGCACAGTTA pLKO.1 432 CDS 100% 4.950 3.465 N MPZL1 n/a
4 TRCN0000117364 CCTTGGAAGTATATACGCCAA pLKO.1 280 CDS 100% 2.160 1.512 N MPZL1 n/a
5 TRCN0000299473 CCTTGGAAGTATATACGCCAA pLKO_005 280 CDS 100% 2.160 1.512 N MPZL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14008 pDONR223 100% 44.1% 42.3% None 257_258ins450;344delA n/a
2 ccsbBroad304_14008 pLX_304 0% 44.1% 42.3% V5 (not translated due to frame shift) 257_258ins450;344delA n/a
3 TRCN0000474240 GGACACTACTCCGTAAAGGTACGT pLX_317 38.8% 44.1% 42.3% V5 (not translated due to frame shift) 257_258ins450;344delA n/a
Download CSV