Construct: ORF TRCN0000474288
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018376.1_s317c1
- Derived from:
- ccsbBroadEn_02598
- DNA Barcode:
- CCCGCACCCCAGGTGATCTTAGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IFT27 (11020)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474288
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11020 | IFT27 | intraflagellar transport 27 | NM_001177701.3 | 99.6% | 82.9% | 472G>A;477_478insT |
| 2 | human | 11020 | IFT27 | intraflagellar transport 27 | NM_001363003.2 | 99.6% | 82.9% | 472G>A;477_478insT |
| 3 | human | 11020 | IFT27 | intraflagellar transport 27 | NM_006860.5 | 99.1% | 82.4% | 32_33insAGG;469G>A;474_475insT |
| 4 | human | 11020 | IFT27 | intraflagellar transport 27 | XM_017028540.2 | 77.6% | 62.3% | 0_1ins123;349G>A;354_355insT |
| 5 | mouse | 67042 | Ift27 | intraflagellar transport 27 | NM_025931.2 | 85.1% | 68.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 627
- ORF length:
- 561
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaagctggca gccaaatgca tcctggcagg agacccagca gtgggcaaga 121 ccgccctggc acagatcttc cgcagtgatg gagcccattt ccagaaaagc tacaccctga 181 caacaggaat ggatttggtg gtgaagacag tgccagttcc tgacacggga gacagtgtgg 241 aactcttcat ttttgactct gctggcaagg agctgttttc ggaaatgctg gataaattgt 301 gggagagtcc caatgtctta tgtctcgtct atgatgtgac caatgaagaa tccttcaaca 361 actgcagcaa gtggctggag aaggctcggt cacaggctcc aggcatctct ctcccaggtg 421 ttttagttgg gaacaagaca gacctggccg gcagacgagc agtggactca gctgaggccc 481 gggcatgggc gctgggccag ggcctggaat gttttgaaac atccgtgaaa gagatgAAAA 541 ACTTTCGAAG CCCCTTTCCA CTGCCTTGCC AAGCAGTTCC ACCAGCTGTA CCGGGAGAAG 601 GTGGAGGTTT TCCGGGCCCT GGCATGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT 661 AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA 721 CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCCGCACCCC 781 AGGTGATCTT AGCAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 841 gatt