Transcript: Mouse NM_025931.2

Mus musculus intraflagellar transport 27 (Ift27), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ift27 (67042)
Length:
1050
CDS:
307..867

Additional Resources:

NCBI RefSeq record:
NM_025931.2
NBCI Gene record:
Ift27 (67042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047387 ACAGTGTGGAACTCTTCATTT pLKO.1 473 CDS 100% 13.200 9.240 N IFT27 n/a
2 TRCN0000102724 CAGTGCCAGTTCTTGACACAA pLKO.1 449 CDS 100% 4.950 3.465 N Ift27 n/a
3 TRCN0000302890 CAGTGCCAGTTCTTGACACAA pLKO_005 449 CDS 100% 4.950 3.465 N Ift27 n/a
4 TRCN0000102723 CTGGATAAGTTGTGGGAGAAT pLKO.1 529 CDS 100% 4.950 3.465 N Ift27 n/a
5 TRCN0000302893 CTGGATAAGTTGTGGGAGAAT pLKO_005 529 CDS 100% 4.950 3.465 N Ift27 n/a
6 TRCN0000102722 CCTTGTCTATGATGTGACCAA pLKO.1 564 CDS 100% 2.640 1.848 N Ift27 n/a
7 TRCN0000302976 CCTTGTCTATGATGTGACCAA pLKO_005 564 CDS 100% 2.640 1.848 N Ift27 n/a
8 TRCN0000102720 ACTGTCCTGAAGGGCTGCCCA pLKO.1 879 3UTR 100% 0.000 0.000 N Ift27 n/a
9 TRCN0000102721 GCCTGGAATTCTTTGAGACAT pLKO.1 743 CDS 100% 0.000 0.000 N Ift27 n/a
10 TRCN0000302889 GCCTGGAATTCTTTGAGACAT pLKO_005 743 CDS 100% 0.000 0.000 N Ift27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02598 pDONR223 100% 85.3% 83.3% None (many diffs) n/a
2 ccsbBroad304_02598 pLX_304 0% 85.3% 83.3% V5 (many diffs) n/a
3 TRCN0000474288 CCCGCACCCCAGGTGATCTTAGCA pLX_317 17% 85.1% 68.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV