Construct: ORF TRCN0000474429
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003734.1_s317c1
- Derived from:
- ccsbBroadEn_13901
- DNA Barcode:
- TCTTGTAGCCTTTTCTAACCAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MRE11 (4361)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474429
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4361 | MRE11 | MRE11 homolog, double stran... | NM_005590.4 | 30.1% | 30% | 13G>T;613G>A;619_2040del |
| 2 | human | 4361 | MRE11 | MRE11 homolog, double stran... | NM_001330347.2 | 29% | 28.8% | 13G>T;613G>A;619_2121del |
| 3 | human | 4361 | MRE11 | MRE11 homolog, double stran... | XM_006718842.3 | 29% | 28.8% | 13G>T;613G>A;619_2121del |
| 4 | human | 4361 | MRE11 | MRE11 homolog, double stran... | NM_005591.3 | 29% | 28.8% | 13G>T;613G>A;619_2124del |
| 5 | human | 4361 | MRE11 | MRE11 homolog, double stran... | XM_011542837.2 | 29% | 28.8% | 13G>T;613G>A;619_2124del |
| 6 | human | 4361 | MRE11 | MRE11 homolog, double stran... | XM_017017772.1 | 29% | 28.8% | 13G>T;613G>A;619_2124del |
| 7 | human | 4361 | MRE11 | MRE11 homolog, double stran... | XR_947828.2 | 11.5% | (many diffs) | |
| 8 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | XM_006510051.2 | 27.8% | 29.8% | (many diffs) |
| 9 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | NM_001310728.1 | 26.4% | 28.2% | (many diffs) |
| 10 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | XM_006510049.2 | 26.4% | 28.2% | (many diffs) |
| 11 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | NM_018736.3 | 25.4% | 27.1% | (many diffs) |
| 12 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | XM_006510048.2 | 25.4% | 27.1% | (many diffs) |
| 13 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | XM_006510052.2 | 12.7% | 13.8% | (many diffs) |
| 14 | mouse | 17535 | Mre11a | MRE11A homolog A, double st... | XR_379107.2 | 9.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 684
- ORF length:
- 618
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tactgcatat gcacttgatg atgaaaacac atttaaaata ttagttgcaa 121 cagatattca tcttggattt atggagaaag atgcagtcag aggaaatgat acgtttgtaa 181 cactcgatga aattttaaga cttgcccagg aaaatgaagt ggattttatt ttgttaggtg 241 gtgatctttt tcatgaaaat aagccctcaa ggaaaacatt acatacctgc ctcgagttat 301 taagaaaata ttgtatgggt gatcggcctg tccagtttga aattctcagt gatcagtcag 361 tcaactttgg ttttagtaag tttccatggg tgaactatca agatggcaac ctcaacattt 421 caattccagt gtttagtatt catggcaatc atgacgatcc cacaggggca gatgcacttt 481 gtgccttgga cattttaagt tgtgcTGGAT TTGTAAATCA CTTTGGACGT TCAATGTCTG 541 TGGAGAAGAT AGACATTAGT CCGGTTTTGC TTCAAAAAGG AAGCACAAAG ATTGCGCTAT 601 ATGGTTTAGG ATCCATTCCA GATGAAAGGC TCTATCGAAT GTTTGTCAAT AAAAAAGTAA 661 CAATGTTGAG ACCAAAGAAA GATTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 721 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 781 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CTTGTAGCCT 841 TTTCTAACCA ACGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 901 att