Transcript: Human NM_001330347.2

Homo sapiens MRE11 homolog, double strand break repair nuclease (MRE11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MRE11 (4361)
Length:
6838
CDS:
160..2283

Additional Resources:

NCBI RefSeq record:
NM_001330347.2
NBCI Gene record:
MRE11 (4361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338391 ACGACTGCGAGTGGACTATAG pLKO_005 1248 CDS 100% 10.800 15.120 N MRE11 n/a
2 TRCN0000039871 CGATTTCTTAAAGAACGTCAT pLKO.1 1606 CDS 100% 4.050 3.240 N MRE11 n/a
3 TRCN0000338394 GTTGAGGGAAAGAGCTTATAA pLKO_005 2585 3UTR 100% 15.000 10.500 N MRE11 n/a
4 TRCN0000338393 TGTTGGTTTGCTGCGTATTAA pLKO_005 1008 CDS 100% 15.000 10.500 N MRE11 n/a
5 TRCN0000338395 ACGGGAACGTCTGGGTAATTC pLKO_005 1203 CDS 100% 13.200 9.240 N MRE11 n/a
6 TRCN0000338324 GCTGATGACCTTATGAGTATA pLKO_005 1783 CDS 100% 13.200 9.240 N MRE11 n/a
7 TRCN0000039870 CCACTTCAAAGACAGATCAAA pLKO.1 2129 CDS 100% 5.625 3.938 N MRE11 n/a
8 TRCN0000039868 GCCCACATCTTTATTGAACTT pLKO.1 3707 3UTR 100% 4.950 3.465 N MRE11 n/a
9 TRCN0000039872 GCTGGATTTGTAAATCACTTT pLKO.1 598 CDS 100% 4.950 3.465 N MRE11 n/a
10 TRCN0000010351 TAAGAGACAGACACTTGGTTA pLKO.1 3510 3UTR 100% 4.950 3.465 N MRE11 n/a
11 TRCN0000039869 GCTGCGTATTAAAGGGAGGAA pLKO.1 1017 CDS 100% 2.640 1.848 N MRE11 n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6483 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5802 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 5223 3UTR 100% 4.050 2.025 Y TLCD4 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5657 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5802 3UTR 100% 5.625 2.813 Y EID2B n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5318 3UTR 100% 4.950 2.475 Y DCAF11 n/a
18 TRCN0000118254 GCAGAGAAGAATGTGCAGCAA pLKO.1 1477 CDS 100% 2.640 1.320 Y PLGLB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13901 pDONR223 100% 29% 28.8% None 13G>T;613G>A;619_2121del n/a
2 ccsbBroad304_13901 pLX_304 0% 29% 28.8% V5 13G>T;613G>A;619_2121del n/a
3 TRCN0000474429 TCTTGTAGCCTTTTCTAACCAACG pLX_317 29.6% 29% 28.8% V5 13G>T;613G>A;619_2121del n/a
Download CSV