Construct: ORF TRCN0000474449
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007332.1_s317c1
- Derived from:
- ccsbBroadEn_12430
- DNA Barcode:
- TGCTCTAATACTGGCAAAATACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC22A23 (63027)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474449
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63027 | SLC22A23 | solute carrier family 22 me... | NR_104448.1 | 8.4% | 1_3802del;4097C>G;4262_5416del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 525
- ORF length:
- 459
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tctcagccgg cgaggcggtc ccacagctct cctcccaggg cagcctgagg 121 aggaggaggc cgggtgcctg tttggtggca gcttcagcct agggatacct gaagctgttg 181 agcaacacct ttatgaaatg ttgccagagc agcaacactt ccctgtgggc acagccccgg 241 gaaatccggt accaagtgag caaggtggca ggacccaccc aagcctgata cgcatctggg 301 cccgccgggc tcagcagggg aggctgctac ggctgcccac ttcccagcac cgtctgtcag 361 gcttgaaccc ctctgtgctg ttcccttcct ggctaatagg gagacccttc gcaggcaccc 421 actgtttcaA CTTGACCCTC CCACCCCCTG CTACTCTCCT CCACACACCC CTCCGTTCCG 481 CTAGCCTACC CTGTCAGCCT TTCAATAAAA GTTATGCACA AATGTGCCCA ACTTTCTTGT 541 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 601 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 661 GAAAGGACGA TGCTCTAATA CTGGCAAAAT ACCCACGCGT TAAGTCgaca atcaacctct 721 ggattacaaa atttgtgaaa gatt