Construct: ORF TRCN0000474542
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016855.1_s317c1
- Derived from:
- ccsbBroadEn_08079
- DNA Barcode:
- TCACAACACCTCTTCTCGCCAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VENTX (27287)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474542
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27287 | VENTX | VENT homeobox | NM_014468.4 | 99.7% | 100% | 144A>G;163C>A |
| 2 | human | 27287 | VENTX | VENT homeobox | XM_017016073.1 | 70.3% | 70.5% | (many diffs) |
| 3 | human | 391518 | VENTXP7 | VENT homeobox pseudogene 7 | NR_002311.1 | 69.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 843
- ORF length:
- 774
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcgcctctcc tcctccccac ctcgtggccc gcagcagctc tccagctttg 121 gctccgtgga ctggctctcc cagagcagct gctcagggcc gacccacacc cccaggcctg 181 ccgacttctc cctggggagc ctccctggcc cgggccagac atccggcgcc agggagcccc 241 ctcaggccgt cagcatcaag gaggccgccg ggtcctcaaa tctgcctgcg ccggagagga 301 ccatggccgg gttgagtaag gagccaaata ccttgcgggc cccccgtgtc cgcacagcct 361 tcaccatgga gcaggtccgc accttggagg gcgtcttcca gcaccaccag tacctgagcc 421 ctctggagcg gaagaggctg gccagggaga tgcagctctc agaggtccag ataaaaacct 481 ggtttcagaa tcgccgcatg aaacacaaac ggcaaatgca ggacccccag ctgcacagcc 541 ccttctcggg gtctctccat gcgcccccag ctttctactc aacgtcttct ggccttgcca 601 atggcctgca gctgctgtgc ccttgggcac ccctgtccgg gccccaggct ctgatgctgc 661 cccctggctc cttctggggt ctctgccaag tggcacaaga ggccctggca tcTGCGGGAG 721 CTTCCTGCTG CGGGCAGCCT CTGGCGTCCC ACCCCCCTAC CCCAGGCCGG CCTTCGCTGG 781 GACCAGCCCT GTCCACGGGG CCCCGGGGCC TGTGTGCTAT GCCACAGACG GGGGATGCAT 841 TTTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGATC ACAACACCTC TTCTCGCCAA CGACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt