Transcript: Human XM_017016073.1

PREDICTED: Homo sapiens VENT homeobox (VENTX), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VENTX (27287)
Length:
990
CDS:
214..783

Additional Resources:

NCBI RefSeq record:
XM_017016073.1
NBCI Gene record:
VENTX (27287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413327 TAAGGAGCCAAATACCTTGCG pLKO_005 255 CDS 100% 2.160 3.024 N VENTX n/a
2 TRCN0000015977 CCGCACCTTGGAGGGCGTCTT pLKO.1 315 CDS 100% 0.000 0.000 N VENTX n/a
3 TRCN0000015974 CCAGCTTTCTACTCAACGTCT pLKO.1 505 CDS 100% 2.640 1.848 N VENTX n/a
4 TRCN0000433691 TTTGAGGAGGCACCTCTGACT pLKO_005 779 CDS 100% 2.640 1.848 N VENTX n/a
5 TRCN0000015973 CATGAAACACAAACGGCAAAT pLKO.1 435 CDS 100% 10.800 6.480 N VENTX n/a
6 TRCN0000418142 GTTTCAGAATCGCCGCATGAA pLKO_005 420 CDS 100% 4.950 2.970 N VENTX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08079 pDONR223 100% 70.3% 70.5% None (many diffs) n/a
2 ccsbBroad304_08079 pLX_304 0% 70.3% 70.5% V5 (many diffs) n/a
3 TRCN0000474542 TCACAACACCTCTTCTCGCCAACG pLX_317 17.6% 70.3% 70.5% V5 (many diffs) n/a
Download CSV