Construct: ORF TRCN0000474659
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015958.1_s317c1
- Derived from:
- ccsbBroadEn_12501
- DNA Barcode:
- AAACCGCCTGTCGTTGGGCTATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLEKHG2 (64857)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474659
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XM_006723334.2 | 67.4% | 67.2% | (many diffs) |
| 2 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XM_017027151.1 | 65.2% | 65.1% | (many diffs) |
| 3 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XM_017027150.1 | 64.9% | 64.7% | (many diffs) |
| 4 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | NM_022835.3 | 64.5% | 64.4% | (many diffs) |
| 5 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XM_005259163.2 | 64.5% | 64.4% | (many diffs) |
| 6 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XM_011527232.2 | 64.5% | 64.3% | (many diffs) |
| 7 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | NM_001351693.2 | 59.3% | 57% | (many diffs) |
| 8 | human | 64857 | PLEKHG2 | pleckstrin homology and Rho... | XR_002958344.1 | 22.1% | 1_2404del;2874G>A;3533_3534ins1559 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2754
- ORF length:
- 2688
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt cccacagaac gctaagcctg gattcaagca cgctggcagc gaaggggaac 121 tctaccctcc agaatctcag ccaccagttt caggctctgc accccctgag gacctggagg 181 atgctggacc cccaacactg gacccctctg ggacctcaat cactgaagaa atcctggaac 241 tgctgaatca gcgaggcctt cgagatccag ggccgtccac ccatgacatt cccaagttcc 301 ccggagactc ccaggtgcct ggcgacagcg aaaccctcac attccaagcc ctgcccagcc 361 gggactcttc agaagaggag gaggaggaag aggaagggct ggagatggat gaacgggggc 421 cttccccact ccacgtcctg gaagggctcg aaagttccat tgcagctgaa atgcccagca 481 ttccctgcct taccaaaatt cctgacgtgc ccaaccttcc tgaaattccc agccactgtg 541 aaattcccga aggttctcgc cttcctagtc tctctgacat ttccgatgtt tttgagatgc 601 cctgccttcc agccatacct agtgtcccca acacccccag tctgtctagc actcccaccc 661 tctcctgtga ctcctggctc caagggcctc tgcaggaacc agctgaggct ccagccacca 721 ggagagaact gttttctggg agcaatcctg ggaaactggg agagccgcct tcaggaggca 781 aggcagggcc agaggaggat gaagaagggg tatcattcac agacttccag ccccaggatg 841 tcacccaaca tcagggattc ccagatgagc tggcattccg ctcttgctca gaaatccgga 901 gcgcctggca ggcattggaa cagggacagc tggcccggcc aggcttccca gagccactgc 961 tgatcctgga ggattcggat ctgggtggag acagcgggag cgggaaggca ggagccccga 1021 gttcagaaag gacggcgtcc cgagtgcgag agctggcccg gctttacagc gagcggatcc 1081 agcagatgca gcgggcggag actcgggcat cagccaatgc cccgcgccgc cggcctcggg 1141 ttctggccca accccagcca tccccctgtc tgccccagga gcaggcagag ccagggctcc 1201 tgcctgcctt tggacacgtg ctggtatgtg agctggcctt cccactgaca tgtgcccagg 1261 agtctgtccc cctgggtcct gctgtctggg ttcaagctgc catacctttg tcaaagcagg 1321 gaggcagccc ggatggccag ggtctacatg tttccaattt gcctaagcaa gaccttccgg 1381 gcatccacgt ttcagctgct acccttttgc ctgagcaagg aggttcccgg catgtccagg 1441 ctccagccgc cacacctttg cccaagcaag aaggccccct gcacctccag gtgccggctc 1501 ttacaacttt ctctgatcaa ggccacccag aaatccaagt tccagccacc actcctttgc 1561 ctgagcataa aagtcacatg gttataccag ctccatccac cgccttttgt cctgagcagg 1621 gacactgtgc ggacatccac gttcccacca ctccagcttt gcccaaggag atttgttctg 1681 atttcacagt ttcagtcacc acccctgtgc ccaagcaaga aggtcaccta gacagcgaga 1741 gcccaaccaa tatcccactg acaaagcaag gaggttccag ggatgttcag ggcccagacc 1801 ctgtctgcag tcaacccatc cagcctttgt cttggcatgg aagcagcctg gatccccagg 1861 gcccaggcga caccctacca cccttgccat gtcacctccc agaccttcag attccaggta 1921 cctcaccttt gcctgcacat ggaagccacc tggaccatcg gatcccagcc aacgccccac 1981 tgtctttgtc ccaggagctc ccagacactc aggttccagc taccacacct ttgcccctgc 2041 cacaagtcct cacagacatc tgggtccaag ccctcccaac ttcacccaag cagggaagcc 2101 tcccagacat ccagggtcca gcggctgcac ctccacttcc ggagccaagc cttacagata 2161 cacaggtcca aaaactcaca ccttcgttgg agcagaagag cctcatagat gcccatgttc 2221 cagctgccac acctttacct gagagaggag gctctctaga cattcagggc ctctcaccca 2281 ccccagttca gaccaccatg gttttgtcca aaccaggagg ctccttagcc tctcacgttg 2341 ccaggttgga gtcttcagac ttgacgccac ctcatagtcc cccaccttcc agccgtcagc 2401 tcctgggccc caatgcagct gccctctcca gatacctggc agccTCATAT ATCAGCCAAA 2461 GCCTGGCTCG GCGGCAGGGG CCTGGGGGAG GGGCCCCCGC AGCCTCCCGG GGCTCCTGGT 2521 CCTCTGCTCC CACGTCACGG GCATCTTCGC CGCCCCCCCA GCCCCAGCCA CCACCTCCCG 2581 CAGCCAGGCG GCTCAGCTAT GCCACGACGG TTAACATCCA CGTGGGCGGG GGTGGGCGGC 2641 TGCGGCCAGC CAAGGCCCAG GTCCGGTTGA ACCACCCTGC TCTCTTGGCC TCCACACAGG 2701 AATCTATGGG CCTTCACAGG GCCCAGGGGG CTCCTGATGC CCCCTTCCAC ATGTGCCCAA 2761 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2821 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2881 TATCTTGTGG AAAGGACGAA AACCGCCTGT CGTTGGGCTA TCCACGCGTT AAGTCgacaa 2941 tcaacctctg gattacaaaa tttgtgaaag att