Transcript: Human XM_006723334.2

PREDICTED: Homo sapiens pleckstrin homology and RhoGEF domain containing G2 (PLEKHG2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHG2 (64857)
Length:
7947
CDS:
854..4837

Additional Resources:

NCBI RefSeq record:
XM_006723334.2
NBCI Gene record:
PLEKHG2 (64857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005470 GTTTCCAATTTGCCTAAGCAA pLKO.1 3431 CDS 100% 3.000 2.400 N PLEKHG2 n/a
2 TRCN0000417170 AGCTATGCCACGACGGTTAAC pLKO_005 4676 CDS 100% 10.800 7.560 N PLEKHG2 n/a
3 TRCN0000005468 CCAAGGAGATTTGTTCTGATT pLKO.1 3744 CDS 100% 4.950 3.465 N PLEKHG2 n/a
4 TRCN0000005469 CTACACATTGTACTGCATGAA pLKO.1 1240 CDS 100% 4.950 3.465 N PLEKHG2 n/a
5 TRCN0000005467 GCAAAGCAAGTTCTCCTTGAA pLKO.1 1940 CDS 100% 4.950 3.465 N PLEKHG2 n/a
6 TRCN0000005466 CCCTCAGAACTTGACCTGGAA pLKO.1 4889 3UTR 100% 2.640 1.848 N PLEKHG2 n/a
7 TRCN0000418017 TCCATTCCCTTGGCAATTTAT pLKO_005 5283 3UTR 100% 15.000 9.000 N PLEKHG2 n/a
8 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 7483 3UTR 100% 4.950 2.475 Y GJD4 n/a
9 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 7483 3UTR 100% 4.950 2.475 Y C9orf85 n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 6478 3UTR 100% 4.950 2.475 Y C16orf89 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 6970 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12501 pDONR223 100% 67.4% 67.2% None (many diffs) n/a
2 ccsbBroad304_12501 pLX_304 0% 67.4% 67.2% V5 (many diffs) n/a
3 TRCN0000474659 AAACCGCCTGTCGTTGGGCTATCC pLX_317 11.8% 67.4% 67.2% V5 (many diffs) n/a
Download CSV