Construct: ORF TRCN0000474723
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007237.1_s317c1
- Derived from:
- ccsbBroadEn_04114
- DNA Barcode:
- CCTGCCCGGCCACCGCCCAATTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SUV39H2 (79723)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474723
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193425.1 | 100% | 100% | |
| 2 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_024670.3 | 100% | 100% | |
| 3 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_006717503.3 | 100% | 100% | |
| 4 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_011519662.2 | 100% | 100% | |
| 5 | human | 79723 | SUV39H2 | suppressor of variegation 3... | XM_017016637.1 | 100% | 100% | |
| 6 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193424.2 | 85.3% | 85.3% | 1_180del |
| 7 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193427.1 | 48.5% | 48.5% | 127_128ins540 |
| 8 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NM_001193426.1 | 41.4% | 41.4% | 1_180del;307_308ins540 |
| 9 | human | 79723 | SUV39H2 | suppressor of variegation 3... | NR_034181.1 | 34.9% | 1_140del;1191_3002del | |
| 10 | mouse | 64707 | Suv39h2 | suppressor of variegation 3... | NM_022724.4 | 62.7% | 64.6% | (many diffs) |
| 11 | mouse | 64707 | Suv39h2 | suppressor of variegation 3... | NR_027509.1 | 21.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1116
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atattatctt gtaaaatgga aaggatggcc agattctaca aatacttggg 121 aacctttgca aaatctgaag tgcccgttac tgcttcagca attctctaat gacaagcata 181 attatttatc tcaggtaaag aaaggcaaag caataactcc aaaagacaat aacaaaactt 241 tgaaacctgc cattgctgag tacattgtga agaaggctaa acaaaggata gctctgcaga 301 gatggcaaga tgaactcaac agaagaaaga atcataaagg aatgatattt gttgaaaata 361 ctgttgattt agagggccca ccttcagact tctattacat taacgaatac aaaccagctc 421 ctggaatcag cttagtcaat gaagctacct ttggttgttc atgcacagat tgcttctttc 481 aaaaatgttg tcctgctgaa gctggagttc ttttggctta taataaaaac caacaaatta 541 aaatcccacc tggtactccc atctatgaat gcaactcaag gtgtcagtgt ggtcctgatt 601 gtcccaatag gattgtacaa aaaggcacac agtattcgct ttgcatcttt cgaactagca 661 atggacgtgg ctggggtgta aagacccttg tgaagattaa aagaatgagt tttgtcatgg 721 aatatgttgg agaggtaatc acaagtgaaG AAGCTGAAAG ACGAGGACAG TTCTATGACA 781 ACAAGGGAAT CACGTATCTC TTTGATCTGG ACTATGAGTC TGATGAATTC ACAGTGGATG 841 CGGCTCGATA CGGCAATGTG TCTCATTTTG TGAATCACAG CTGTGACCCA AATCTTCAGG 901 TGTTCAATGT TTTCATTGAT AACCTCGATA CTCGTCTTCC CCGAATAGCA TTGTTTTCCA 961 CAAGAACCAT AAATGCTGGA GAAGAGCTGA CTTTTGATTA TCAAATGAAA GGTTCTGGAG 1021 ATATATCTTC AGATTCTATT GACCACAGCC CAGCCAAAAA GAGGGTCAGA ACAGTATGTA 1081 AATGTGGAGC TGTGACTTGC AGAGGTTACC TCAACTGCCC AACTTTCTTG TACAAAGTGG 1141 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1201 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1261 ACCTGCCCGG CCACCGCCCA ATTATACGCG TTAAGTCgac aatcaacctc tggattacaa 1321 aatttgtgaa agatt