Construct: ORF TRCN0000474776
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009581.1_s317c1
- Derived from:
- ccsbBroadEn_04639
- DNA Barcode:
- CCTCTGTCACATTAGCATCGATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTFR2 (113115)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474776
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 113115 | MTFR2 | mitochondrial fission regul... | NM_001099286.3 | 100% | 100% | |
| 2 | human | 113115 | MTFR2 | mitochondrial fission regul... | NM_138419.5 | 100% | 100% | |
| 3 | human | 113115 | MTFR2 | mitochondrial fission regul... | NM_001318738.2 | 88.8% | 88.8% | 0_1ins129 |
| 4 | human | 113115 | MTFR2 | mitochondrial fission regul... | XM_011535410.2 | 88.8% | 88.8% | 0_1ins129 |
| 5 | human | 113115 | MTFR2 | mitochondrial fission regul... | XM_011535412.2 | 88.8% | 88.8% | 0_1ins129 |
| 6 | human | 113115 | MTFR2 | mitochondrial fission regul... | XM_011535413.2 | 88.8% | 88.8% | 0_1ins129 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1221
- ORF length:
- 1155
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tctcatactg aatatcttaa gagagatgct ggaatatttt ggcgttcctg 121 tagaacaggt tttgctgatt tgggaaaata aagactatgg atcaactagg agtattgttc 181 gtattattgg gaaaatgctt ccactggaac cttgtcgaag acctaatttt gagttgatcc 241 cgctcttgaa ctctgtagac tctgataatt gtggatctat ggttccatct tttgctgata 301 ttttgtatgt ggcaaatgat gaagaagcca gttatctcag atttcgaaat agtatatgga 361 aaaatgaaga agagaaagtg gaaatttttc atcctttgcg actagttcgg gatccactgt 421 cacctgctgt aagacagaaa gaaactgtga aaaatgacct gcctgtaaat gaagctgcaa 481 ttagaaaaat agctgccctt gaaaatgagc tgacttttct tcgctctcag attgcagcaa 541 ttgtggaaat gcaggaactg aaaaatagta caaattctag ttcctttggc ttgagtgacg 601 agcgcattag tttgggtcag ctgtcatcat cgcgggctgc ccatctgagt gtggacccag 661 atcagcttcc aggttcagtg ctttctcctc ctcctcctcc accacttcct cctcagtttt 721 catctctcca gccaccgtgt tttcctcccg tacaaccagg atctaataat atttgtgact 781 cagataatcc agcaactgaa atgagcaaac agaacccggc tgctaataag accaattATA 841 GTCATCATTC AAAAAGCCAG AGAAATAAAG ATATTCCAAA CATGTTGGAC GTTCTAAAGG 901 ATATGAATAA GGTTAAGCTT CGTGCAATTG AGCGGTCACC TGGCGGTAGA CCCATTCATA 961 AGAGGAAAAG ACAGAATTCA CATTGGGATC CAGTTTCTTT AATATCTCAT GCACTTAAAC 1021 AGAAATTTGC ATTTCAAGAA GATGATTCTT TTGAGAAAGA GAATAGATCT TGGGAATCTT 1081 CCCCATTTTC TAGTCCAGAA ACTTCAAGGT TTGGACATCA CATTTCACAG TCAGAAGGAC 1141 AGCGAACTAA AGAAGAAATG GTCAACACAA AAGCTGTTGA CCAAGGTATC AGCAACACAA 1201 GCCTTCTAAA CTCAAGGATT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1261 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1321 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCTC TGTCACATTA 1381 GCATCGATTT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt