Transcript: Human XM_011535410.2

PREDICTED: Homo sapiens mitochondrial fission regulator 2 (MTFR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTFR2 (113115)
Length:
1881
CDS:
608..1636

Additional Resources:

NCBI RefSeq record:
XM_011535410.2
NBCI Gene record:
MTFR2 (113115)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167345 CAACTTAAGGTTGAGCTTTAA pLKO.1 1640 3UTR 100% 13.200 18.480 N MTFR2 n/a
2 TRCN0000441777 GCTTGAGTGACGAGCGCATTA pLKO_005 1002 CDS 100% 10.800 15.120 N MTFR2 n/a
3 TRCN0000134197 CTCAACTTAAGGTTGAGCTTT pLKO.1 1638 3UTR 100% 0.495 0.396 N MTFR2 n/a
4 TRCN0000431543 ACAGAACCCGGCTGCTAATAA pLKO_005 1222 CDS 100% 15.000 10.500 N MTFR2 n/a
5 TRCN0000430639 CCGTACAACCAGGATCTAATA pLKO_005 1161 CDS 100% 13.200 9.240 N MTFR2 n/a
6 TRCN0000167377 GAAACTGATTTGGACTGTTAA pLKO.1 1699 3UTR 100% 13.200 9.240 N MTFR2 n/a
7 TRCN0000422954 GTTATCTCAGATTTCGAAATA pLKO_005 744 CDS 100% 13.200 9.240 N MTFR2 n/a
8 TRCN0000431122 TCAGAAGGACAGCGAACTAAA pLKO_005 1544 CDS 100% 13.200 9.240 N MTFR2 n/a
9 TRCN0000135221 CCAAACATGTTGGACGTTCTA pLKO.1 1289 CDS 100% 4.950 3.465 N MTFR2 n/a
10 TRCN0000201252 GCCTGTAAATGAAGCTGCAAT pLKO.1 874 CDS 100% 4.950 3.465 N Mtfr2 n/a
11 TRCN0000135607 GTGGATCTATGGTTCCATCTT pLKO.1 684 CDS 100% 4.950 3.465 N MTFR2 n/a
12 TRCN0000167767 GTTGAGCTTTAAACTTCCAAA pLKO.1 1649 3UTR 100% 4.950 3.465 N MTFR2 n/a
13 TRCN0000136201 GCAATTGTGGAAATGCAGGAA pLKO.1 950 CDS 100% 2.640 1.848 N MTFR2 n/a
14 TRCN0000352470 GTAAATGAAGCTGCAATTAAA pLKO_005 878 CDS 100% 15.000 10.500 N Mtfr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04639 pDONR223 100% 88.8% 88.8% None 0_1ins129 n/a
2 ccsbBroad304_04639 pLX_304 0% 88.8% 88.8% V5 0_1ins129 n/a
3 TRCN0000474776 CCTCTGTCACATTAGCATCGATTT pLX_317 33.5% 88.8% 88.8% V5 0_1ins129 n/a
4 ccsbBroadEn_13015 pDONR223 100% 65.4% 65.4% None 1_354del n/a
5 ccsbBroad304_13015 pLX_304 0% 65.4% 65.4% V5 1_354del n/a
6 TRCN0000474573 GAACGCGATGCCACTCCGAGACTC pLX_317 70.2% 65.4% 65.4% V5 1_354del n/a
Download CSV