Construct: ORF TRCN0000474795
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008575.1_s317c1
- Derived from:
- ccsbBroadEn_02935
- DNA Barcode:
- CTTCGGCACCAAAATCACTTGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC29 (26231)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474795
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26231 | LRRC29 | leucine rich repeat contain... | NM_001004055.1 | 100% | 100% | |
| 2 | human | 26231 | LRRC29 | leucine rich repeat contain... | NM_001365158.1 | 100% | 100% | |
| 3 | human | 26231 | LRRC29 | leucine rich repeat contain... | NM_001365159.1 | 100% | 100% | |
| 4 | human | 26231 | LRRC29 | leucine rich repeat contain... | NM_012163.2 | 100% | 100% | |
| 5 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023131.1 | 100% | 100% | |
| 6 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023134.1 | 100% | 100% | |
| 7 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023130.1 | 90.2% | 73.9% | 1_7delATGCAGG;147_211del |
| 8 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023126.1 | 66.3% | 66.3% | 140_478del |
| 9 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023127.1 | 66.3% | 66.3% | 140_478del |
| 10 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023128.1 | 66.3% | 66.3% | 140_478del |
| 11 | human | 26231 | LRRC29 | leucine rich repeat contain... | XM_017023129.1 | 66.3% | 66.3% | 140_478del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 735
- ORF length:
- 669
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta cagctctggg tggcctgcag gagctgcaga gcctcgacat ggccgagggc 121 gggaactggc ccaggccctg ggctgtatgc acggggctcc atcccagctg gcctccctca 181 gcctggccca ctgctcttca ttgaagtcac gcccagagct ggagcatcag gcctcaggta 241 ccaaggacgc ctgtccagag ccacagggcc cctccctgct cacgctgcgg gccctgcagg 301 agttggacct cacagcctgc agcaagctga ctgatgccag tttagccaag gtgctccagt 361 ttctccagct gaggcagctg tcccTTAGCC TGTTGCCAGA ACTCACAGAC AACGGCTTGG 421 TTGCTGTGGC CAGGGGCTGT CCTAGCCTGG AGCACTTGGC GCTGAGTCAC TGCAGCCGAC 481 TCAGTGACAA GGGCTGGGCC CAGGCAGCCA GCTCCTGGCC AAGGCTGCAG CATCTCAACC 541 TGTCCAGCTG CAGTCAGCTC ATAGAGCAGA CACTGGATGC TATTGGGCAG GCGTGCAGGC 601 AGCTCCGGGT GTTGGATGTG GCCACGTGCC CTGGCATCAA CATGGCCGCC GTCAGACGCT 661 TCCAAGCCCA GCTGCCCCAG GTGTCCTGTG TCCAGTCCCG CTTCGTGGGA GGGGCTGACC 721 TGACCCTAAC ACTCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 781 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 841 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTTCGGCACC AAAATCACTT 901 GTCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt