Transcript: Human NM_001365158.1

Homo sapiens leucine rich repeat containing 29 (LRRC29), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
LRRC29 (26231)
Length:
1547
CDS:
410..1081

Additional Resources:

NCBI RefSeq record:
NM_001365158.1
NBCI Gene record:
LRRC29 (26231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414424 GAGCAGACACTGGATGCTATT pLKO_005 908 CDS 100% 10.800 7.560 N LRRC29 n/a
2 TRCN0000022379 CTGTGCTGTAAATCCTAAGAT pLKO.1 1509 3UTR 100% 5.625 3.938 N LRRC29 n/a
3 TRCN0000425514 TGGAAATGCTACCTACGTGTT pLKO_005 1291 3UTR 100% 4.050 2.835 N LRRC29 n/a
4 TRCN0000022383 CTGACCTGACCCTAACACTCT pLKO.1 1059 CDS 100% 2.640 1.848 N LRRC29 n/a
5 TRCN0000022381 GATGCCAGTTTAGCCAAGGTG pLKO.1 677 CDS 100% 2.640 1.848 N LRRC29 n/a
6 TRCN0000022380 TGATGCCAGTTTAGCCAAGGT pLKO.1 676 CDS 100% 2.640 1.848 N LRRC29 n/a
7 TRCN0000022382 CAGAACTCACAGACAACGGCT pLKO.1 741 CDS 100% 0.660 0.396 N LRRC29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02935 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02935 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474795 CTTCGGCACCAAAATCACTTGTCC pLX_317 52.3% 100% 100% V5 n/a
Download CSV