Construct: ORF TRCN0000474979
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010559.1_s317c1
- Derived from:
- ccsbBroadEn_00391
- DNA Barcode:
- TTACAATAAATATTGATCCCTAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CTH (1491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474979
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1491 | CTH | cystathionine gamma-lyase | NM_001902.6 | 100% | 100% | |
2 | human | 1491 | CTH | cystathionine gamma-lyase | NM_001190463.1 | 92% | 92% | 250_251ins96 |
3 | human | 1491 | CTH | cystathionine gamma-lyase | NM_153742.4 | 89.1% | 89.1% | 454_455ins132 |
4 | human | 1491 | CTH | cystathionine gamma-lyase | XM_005270509.3 | 73% | 73% | 0_1ins327 |
5 | human | 1491 | CTH | cystathionine gamma-lyase | XM_017000416.2 | 53% | 53% | 0_1ins570 |
6 | mouse | 107869 | Cth | cystathionase (cystathionin... | NM_145953.2 | 80.2% | 83.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1281
- ORF length:
- 1215
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tttgcatgca ggaaaaagac gcctcctcac aaggtttcct gccacacttc caacatttcg 121 ccacgcaggc gatccatgtg ggccaggatc cagagcaatg gacctccagg gctgtagtgc 181 cccccatctc actgtccacc acgttcaagc aaggggcgcc tggccagcac tcgggttttg 241 aatatagccg ttctggaaat cccactagga attgccttga aaaagcagtg gcagcactgg 301 atggggctaa gtactgtttg gcctttgctt caggtttagc agccactgta actattaccc 361 atcttttaaa agcaggagac caaattattt gtatggatga tgtgtatgga ggtacaaaca 421 ggtacttcag gcaagtggca tctgaatttg gattaaagat ttcttttgtt gattgttcca 481 aaatcaaatt actagaggca gcaattacac cagaaaccaa gcttgtttgg atcgaaaccc 541 ccacaaaccc cacccagaag gtgattgaca ttgaaggctg tgcacatatt gtccataagc 601 atggagacat tattttggtc gtggataaca cttttatgtc accatatttc cagcgccctt 661 tggctctggg agctgatatt tctatgtatt ctgcaacaaa atacatgaat ggccacagtg 721 atgttgtaat gggcctggtg tctgttaatt gtgaaagcct tcataataga cttcgtttct 781 tgcaaaactc tcttggagca gttccatctc ctattgattg ttacctctgc aatcgaggTC 841 TGAAGACTCT ACATGTCCGA ATGGAAAAGC ATTTCAAAAA CGGAATGGCA GTTGCCCAGT 901 TCCTGGAATC TAATCCTTGG GTAGAAAAGG TTATTTATCC TGGGCTGCCC TCTCATCCAC 961 AGCATGAGTT GGTGAAGCGT CAGTGTACAG GTTGTACAGG GATGGTCACC TTTTATATTA 1021 AGGGCACTCT TCAGCATGCT GAGATTTTCC TCAAGAACCT AAAGCTATTT ACTCTGGCCG 1081 AGAGCTTGGG AGGATTCGAA AGCCTTGCTG AGCTTCCGGC AATCATGACT CATGCATCAG 1141 TTCTTAAGAA TGACAGAGAT GTCCTTGGAA TTAGTGACAC ACTGATTCGA CTTTCTGTGG 1201 GCTTAGAGGA TGAGGAAGAC CTACTGGAAG ATCTAGATCA AGCTTTGAAG GCAGCACACC 1261 CTCCAAGTGG AAGTCACAGC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1321 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1381 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTAC AATAAATATT 1441 GATCCCTAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt