Construct: ORF TRCN0000474994
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011909.1_s317c1
- Derived from:
- ccsbBroadEn_02760
- DNA Barcode:
- AAAGTTGAAACTACCTCACACGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SIRT4 (23409)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474994
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23409 | SIRT4 | sirtuin 4 | NM_012240.2 | 100% | 100% | |
| 2 | human | 23409 | SIRT4 | sirtuin 4 | XM_006719308.3 | 100% | 100% | |
| 3 | human | 23409 | SIRT4 | sirtuin 4 | XM_006719309.4 | 100% | 100% | |
| 4 | human | 23409 | SIRT4 | sirtuin 4 | XM_005253865.4 | 71% | 71% | 220_221ins273 |
| 5 | human | 23409 | SIRT4 | sirtuin 4 | XM_024448907.1 | 71% | 71% | 220_221ins273 |
| 6 | mouse | 75387 | Sirt4 | sirtuin 4 | NM_001167691.1 | 76.8% | 80.3% | (many diffs) |
| 7 | mouse | 75387 | Sirt4 | sirtuin 4 | NM_133760.1 | 76.8% | 80.3% | (many diffs) |
| 8 | mouse | 75387 | Sirt4 | sirtuin 4 | XM_017321127.1 | 76.8% | 80.3% | (many diffs) |
| 9 | mouse | 75387 | Sirt4 | sirtuin 4 | XM_006530483.3 | 74.8% | 78.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1011
- ORF length:
- 942
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagatgagc tttgcgttga ctttcaggtc agcaaaaggc cgttggatcg 121 caaaccccag ccagccgtgc tcgaaagcct ccattgggtt atttgtgcca gcaagtcctc 181 ctctggaccc tgagaaggtc aaagagttac agcgcttcat caccctttcc aagagactcc 241 ttgtgatgac tggggcagga atctccaccg aatcggggat accagactac aggtcagaaa 301 aagtggggct ttatgcccgc actgaccgca ggcccatcca gcatggtgat tttgtccgga 361 gtgccccaat ccgccagcgg tactgggcga gaaacttcgt aggctggcct caattctcct 421 cccaccagcc taaccctgca cactgggctt tgagcacctg ggagaaactc ggaaagctgt 481 actggttggt gacccaaaat gtggatgctt tgcacaccaa ggcggggagt cggcgcctga 541 cagagctcca cggatgcatg gacagggtcc tgtgcttgga ttgtggggaa cagactcccc 601 ggggggtgct gcaagagcgt ttccaagtcc tgaaccccac ctggagtgct gaggcccatg 661 gcctggctcc tgatggtgac gtctttctct cagaggagca agtccggagc tttcaggtcc 721 caacctgcgt tcaatgtgga ggccatctga aaccagatgt cgttttcttc ggggacacag 781 tgaaccctga caaggttgat tttgtgcaca agcgtgtaaa agaagccgac tccctcttgg 841 tggtgggatc atccttgcag gtatactctG GTTACAGGTT TATCCTCACT GCCTGGGAGA 901 AGAAGCTCCC GATTGCAATA CTGAACATTG GGCCCACACG GTCGGATGAC TTGGCGTGTC 961 TGAAACTGAA TTCTCGTTGT GGAGAGTTGC TGCCTTTGAT AGACCCATGC TTGCCAACTT 1021 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGAAAAG TTGAAACTAC CTCACACGAC ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt