Transcript: Human XM_006719309.4

PREDICTED: Homo sapiens sirtuin 4 (SIRT4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIRT4 (23409)
Length:
1892
CDS:
742..1686

Additional Resources:

NCBI RefSeq record:
XM_006719309.4
NBCI Gene record:
SIRT4 (23409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018946 GAACCCTGACAAGGTTGATTT pLKO.1 1455 CDS 100% 13.200 18.480 N SIRT4 n/a
2 TRCN0000232895 GAACCCTGACAAGGTTGATTT pLKO_005 1455 CDS 100% 13.200 18.480 N SIRT4 n/a
3 TRCN0000018944 CCCGATTGCAATACTGAACAT pLKO.1 1581 CDS 100% 4.950 6.930 N SIRT4 n/a
4 TRCN0000232897 GCTGACCACAGCCTGATATTC pLKO_005 1682 CDS 100% 13.200 9.240 N SIRT4 n/a
5 TRCN0000232898 ACAGGGACTTTCACTTGAATC pLKO_005 1714 3UTR 100% 10.800 7.560 N SIRT4 n/a
6 TRCN0000232894 CTCCTGATGGTGACGTCTTTC pLKO_005 1340 CDS 100% 10.800 7.560 N SIRT4 n/a
7 TRCN0000232896 GGATCATCCTTGCAGGTATAC pLKO_005 1519 CDS 100% 10.800 7.560 N SIRT4 n/a
8 TRCN0000018947 GCGCTTCATCACCCTTTCCAA pLKO.1 885 CDS 100% 3.000 2.100 N SIRT4 n/a
9 TRCN0000018945 CCGTGCTCGAAAGCCTCCATT pLKO.1 808 CDS 100% 1.650 1.155 N SIRT4 n/a
10 TRCN0000018948 CCAGCGGTACTGGGCGAGAAA pLKO.1 1047 CDS 100% 0.000 0.000 N SIRT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719309.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02760 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02760 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474994 AAAGTTGAAACTACCTCACACGAC pLX_317 15.7% 100% 100% V5 n/a
Download CSV