Construct: ORF TRCN0000475013
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016052.1_s317c1
- Derived from:
- ccsbBroadEn_08901
- DNA Barcode:
- TATCCTTTTCATGATTGTTCCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OTUB2 (78990)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475013
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 78990 | OTUB2 | OTU deubiquitinase, ubiquit... | NM_023112.4 | 99.8% | 100% | 336T>C |
| 2 | mouse | 68149 | Otub2 | OTU domain, ubiquitin aldeh... | NM_026580.4 | 91.5% | 94.8% | (many diffs) |
| 3 | mouse | 68149 | Otub2 | OTU domain, ubiquitin aldeh... | XM_006516185.3 | 77.2% | 79.7% | (many diffs) |
| 4 | mouse | 68149 | Otub2 | OTU domain, ubiquitin aldeh... | NM_001177841.1 | 66.3% | 68.4% | (many diffs) |
| 5 | mouse | 68149 | Otub2 | OTU domain, ubiquitin aldeh... | NR_033587.1 | 20.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 768
- ORF length:
- 702
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tgaaacatct ttcaacctaa tatcagaaaa atgtgacatt ctatccattc 121 ttcgggacca tcctgaaaac aggatttacc ggaggaaaat cgaggaactc agcaaaaggt 181 tcaccgccat ccgcaagacc aaaggggatg ggaactgctt ctacagggcc ttgggctatt 241 cctacctgga gtccctgctg gggaagagca gggagatctt caagttcaaa gaacgcgtac 301 tgcagacccc aaatgacctt ctggctgctg gctttgagga gcacaagttc agaaacttct 361 tcaatgcttt ttacagtgtg gtggaactgg tagagaagga cggctcagtg tccagcctgc 421 tgaaggtgtt caacgaccag agtgcctcgg accacatcgt gcagttcctg cgcctgctca 481 cgtcggcctt catcaggaac cgagcagact tcttccggca cTTCATTGAT GAGGAGATGG 541 ACATCAAAGA CTTCTGCACT CACGAAGTAG AGCCCATGGC CACGGAGTGT GACCACATCC 601 AGATCACGGC GTTGTCGCAG GCCCTGAGCA TTGCCCTGCA AGTGGAGTAC GTGGACGAGA 661 TGGATACCGC CCTGAACCAC CACGTGTTCC CTGAGGCCGC CACCCCTTCC GTTTACCTGC 721 TCTATAAAAC ATCCCACTAC AACATCCTTT ATGCAGCCGA TAAACATTGC CCAACTTTCT 781 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 841 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 901 GTGGAAAGGA CGATATCCTT TTCATGATTG TTCCTTCACG CGTTAAGTCg acaatcaacc 961 tctggattac aaaatttgtg aaagatt