Transcript: Human NM_023112.4

Homo sapiens OTU deubiquitinase, ubiquitin aldehyde binding 2 (OTUB2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
OTUB2 (78990)
Length:
3911
CDS:
199..903

Additional Resources:

NCBI RefSeq record:
NM_023112.4
NBCI Gene record:
OTUB2 (78990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230820 AGCCGATAAACATTGATTAAT pLKO_005 888 CDS 100% 15.000 21.000 N OTUB2 n/a
2 TRCN0000257392 TCCGTTTACCTGCTCTATAAA pLKO_005 841 CDS 100% 15.000 21.000 N OTUB2 n/a
3 TRCN0000022411 CGAGATGGATACCGCCCTGAA pLKO.1 789 CDS 100% 1.350 1.080 N OTUB2 n/a
4 TRCN0000230821 CCTATGTGTCACTGGATTATT pLKO_005 3521 3UTR 100% 15.000 10.500 N OTUB2 n/a
5 TRCN0000218059 TCCCACTACAACATCCTTTAT pLKO_005 865 CDS 100% 13.200 9.240 N OTUB2 n/a
6 TRCN0000230819 TCTACAGGGCCTTGGGCTATT pLKO_005 353 CDS 100% 10.800 7.560 N OTUB2 n/a
7 TRCN0000030986 GATGAGGAGATGGACATCAAA pLKO.1 661 CDS 100% 5.625 3.938 N Otub2 n/a
8 TRCN0000022412 CATCCCACTACAACATCCTTT pLKO.1 863 CDS 100% 4.950 3.465 N OTUB2 n/a
9 TRCN0000022410 CCTTCCGTTTACCTGCTCTAT pLKO.1 838 CDS 100% 4.950 3.465 N OTUB2 n/a
10 TRCN0000022413 TGTGGTGGAACTGGTAGAGAA pLKO.1 510 CDS 100% 4.950 3.465 N OTUB2 n/a
11 TRCN0000022409 TGGGCTGCTATGTCTCTGTAT pLKO.1 2740 3UTR 100% 4.950 2.970 N OTUB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023112.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08901 pDONR223 100% 99.8% 100% None 336T>C n/a
2 ccsbBroad304_08901 pLX_304 0% 99.8% 100% V5 336T>C n/a
3 TRCN0000475013 TATCCTTTTCATGATTGTTCCTTC pLX_317 35.5% 99.8% 100% V5 336T>C n/a
4 ccsbBroadEn_12523 pDONR223 100% 31.1% 31.1% None 220_702del n/a
5 ccsbBroad304_12523 pLX_304 0% 31.1% 31.1% V5 220_702del n/a
6 TRCN0000478394 ACTCAGAGCCTAATCTGCCATATG pLX_317 100% 31.1% 31.1% V5 220_702del n/a
7 TRCN0000489385 TAGAGGTGGTATGTAAGCGCAGTG pLX_317 100% 31.1% 31.1% V5 (not translated due to prior stop codon) 220_702del n/a
Download CSV