Construct: ORF TRCN0000475145
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017567.1_s317c1
- Derived from:
- ccsbBroadEn_10292
- DNA Barcode:
- AGGCGGTTCTCTCTCTTGTTGGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAGE3 (139793)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475145
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 139793 | PAGE3 | PAGE family member 3 | NM_001017931.2 | 100% | 100% | |
| 2 | human | 139793 | PAGE3 | PAGE family member 3 | NM_001171252.1 | 100% | 100% | |
| 3 | human | 139793 | PAGE3 | PAGE family member 3 | NM_001303613.1 | 100% | 100% | |
| 4 | human | 139793 | PAGE3 | PAGE family member 3 | XM_017029282.2 | 99.7% | 99.1% | 103A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 408
- ORF length:
- 339
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtggacat caaagaacaa gatccagatc tagagaaaga agagatgatc 121 aagactctaa tcatccagta ggggctgtgg ttgcccagga gctgcccagt gatgaccagc 181 ttcaacaaga ggaaccacca attgaaagtc aggattatac acctggtcaa gagagagacg 241 agggagcact ggacttccaa gtgctaggcc tggcagccta tctctgggaa ctgactcggt 301 caaagactgg gggtgaacgt ggagatggtc ctaatgtcaa gggagaattt cTGCCAAATC 361 TGGAGCCTGT TAAAATACCA GAAGCAGGTG AAGGGCAACC ATCGGTTTTG CCAACTTTCT 421 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 481 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 541 GTGGAAAGGA CGAAGGCGGT TCTCTCTCTT GTTGGCCACG CGTTAAGTCg acaatcaacc 601 tctggattac aaaatttgtg aaagatt