Transcript: Human NM_001171252.1

Homo sapiens PAGE family member 3 (PAGE3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
PAGE3 (139793)
Length:
756
CDS:
324..665

Additional Resources:

NCBI RefSeq record:
NM_001171252.1
NBCI Gene record:
PAGE3 (139793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115776 CTGGGAACTGACTCGGTCAAA pLKO.1 539 CDS 100% 4.950 6.930 N PAGE3 n/a
2 TRCN0000115772 CCTAATGTCAAGGGAGAATTT pLKO.1 585 CDS 100% 13.200 9.240 N PAGE3 n/a
3 TRCN0000115774 GAACGTGGAGATGGTCCTAAT pLKO.1 570 CDS 100% 10.800 7.560 N PAGE3 n/a
4 TRCN0000115773 CAAGACTCTAATCATCCAGTA pLKO.1 375 CDS 100% 4.050 2.835 N PAGE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10292 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10292 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475145 AGGCGGTTCTCTCTCTTGTTGGCC pLX_317 18.5% 100% 100% V5 n/a
Download CSV