Construct: ORF TRCN0000475196
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012429.1_s317c1
- Derived from:
- ccsbBroadEn_01105
- DNA Barcode:
- GGGAGTTCAAGCCCCGCACCCGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PNP (4860)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475196
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4860 | PNP | purine nucleoside phosphory... | NM_000270.3 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 936
- ORF length:
- 867
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagaacgga tacacctatg aagattataa gaacactgca gaatggcttc 121 tgtctcacac taagcaccga cctcaagttg caataatctg tggttctgga ttaggaggtc 181 tgactgataa attaactcag gcccagatct ttgactacgg tgaaatcccc aactttcccc 241 gaagtacagt gccaggtcat gctggccgac tggtgtttgg gttcctgaat ggcagggcct 301 gtgtgatgat gcagggcagg ttccacatgt atgaagggta cccactctgg aaggtgacat 361 tcccagtgag ggttttccac cttctgggtg tggacaccct ggtagtcacc aatgcagcag 421 gagggctgaa ccccaagttt gaggttggag atatcatgct gatccgtgac catatcaacc 481 tacctggttt cagtggtcag aaccctctca gagggcccaa tgatgaaagg tttggagatc 541 gtttccctgc catgtctgat gcctacgacc ggacTATGAG GCAGAGGGCT CTCAGTACCT 601 GGAAACAAAT GGGGGAGCAA CGTGAGCTAC AGGAAGGCAC CTATGTGATG GTGGCAGGCC 661 CCAGCTTTGA GACTGTGGCA GAATGTCGTG TGCTGCAGAA GCTGGGAGCA GACGCTGTTG 721 GCATGAGTAC AGTACCAGAA GTTATCGTTG CACGGCACTG TGGACTTCGA GTCTTTGGCT 781 TCTCACTCAT CACTAACAAG GTCATCATGG ATTATGAAAG CCTGGAGAAG GCCAACCATG 841 AAGAAGTCTT AGCAGCTGGC AAACAAGCTG CACAGAAATT GGAACAGTTT GTCTCCATTC 901 TTATGGCCAG CATTCCACTC CCTGACAAAG CCAGTTTGCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 AGGGAGTTCA AGCCCCGCAC CCGCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt