Transcript: Human NM_000270.3

Homo sapiens purine nucleoside phosphorylase (PNP), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PNP (4860)
Length:
2438
CDS:
147..1016

Additional Resources:

NCBI RefSeq record:
NM_000270.3
NBCI Gene record:
PNP (4860)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430660 CAAGTTTGAGGTTGGAGATAT pLKO_005 512 CDS 100% 13.200 9.240 N PNP n/a
2 TRCN0000431890 CTCAGTTCTGCCTTATCTAAA pLKO_005 1394 3UTR 100% 13.200 9.240 N PNP n/a
3 TRCN0000083280 GCTCTCAGTACCTGGAAACAA pLKO.1 666 CDS 100% 5.625 3.938 N PNP n/a
4 TRCN0000083279 GCTGTTGGCATGAGTACAGTA pLKO.1 792 CDS 100% 4.950 3.465 N PNP n/a
5 TRCN0000083281 ACTCATCACTAACAAGGTCAT pLKO.1 863 CDS 100% 4.050 2.835 N PNP n/a
6 TRCN0000083278 CCTCTTCTCAAAGCTGGGATT pLKO.1 1186 3UTR 100% 4.050 2.835 N PNP n/a
7 TRCN0000083282 ACCTGGTTTCAGTGGTCAGAA pLKO.1 560 CDS 100% 4.950 2.970 N PNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01105 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01105 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475196 GGGAGTTCAAGCCCCGCACCCGCT pLX_317 41.7% 100% 100% V5 n/a
Download CSV