Construct: ORF TRCN0000475205
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014885.1_s317c1
- Derived from:
- ccsbBroadEn_04881
- DNA Barcode:
- CTGACTGACATGGAGCGTTAGCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C4orf36 (132989)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475205
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 132989 | C4orf36 | chromosome 4 open reading f... | NM_001369888.1 | 99.7% | 99.1% | 107C>A |
| 2 | human | 132989 | C4orf36 | chromosome 4 open reading f... | NM_001369889.1 | 99.7% | 99.1% | 107C>A |
| 3 | human | 132989 | C4orf36 | chromosome 4 open reading f... | NM_144645.4 | 99.7% | 99.1% | 107C>A |
| 4 | human | 132989 | C4orf36 | chromosome 4 open reading f... | XM_011531612.3 | 99.7% | 99.1% | 107C>A |
| 5 | human | 132989 | C4orf36 | chromosome 4 open reading f... | XM_011531613.3 | 99.7% | 99.1% | 107C>A |
| 6 | human | 132989 | C4orf36 | chromosome 4 open reading f... | XM_011531615.3 | 99.7% | 99.1% | 107C>A |
| 7 | human | 132989 | C4orf36 | chromosome 4 open reading f... | XM_017007746.2 | 99.7% | 99.1% | 107C>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 417
- ORF length:
- 351
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtatggagtg ccaagaaaga acacagtgaa aaccattttg cggggcagtt 121 gttataatgt acaggaacct tgggatattg cattgcttgc aaagacctgg tacacaaacc 181 tagccaatat caagttgcct ttcttggaag aaatttcatt tggtggttct gtgcagctca 241 caaaatgtac caccattaaa gatggactgc tcccttcTGC AGAATCTATC AAACTCGAAA 301 GGGAGTATGA AGTGAAGCGT CTTTGTAAAC TGAAGTGTCA AGAAAATACA TCTAAGGAAA 361 TTCAGCTTCT CCTGAGGGAA AGGCCAGCCG GTTTGAGAAG ACCTCTTCCA TCTAAATGCC 421 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 481 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 541 ATATATCTTG TGGAAAGGAC GACTGACTGA CATGGAGCGT TAGCCGACGC GTTAAGTCga 601 caatcaacct ctggattaca aaatttgtga aagatt