Transcript: Human NM_001369888.1

Homo sapiens chromosome 4 open reading frame 36 (C4orf36), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
C4orf36 (132989)
Length:
1238
CDS:
434..787

Additional Resources:

NCBI RefSeq record:
NM_001369888.1
NBCI Gene record:
C4orf36 (132989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416851 GGGCAGTTGTTATAATGTACA pLKO_005 481 CDS 100% 4.950 6.930 N C4orf36 n/a
2 TRCN0000428777 ATCTAAGGAAATTCAGCTTCT pLKO_005 718 CDS 100% 4.050 3.240 N C4orf36 n/a
3 TRCN0000134809 CACAAACCTAGCCAATATCAA pLKO.1 541 CDS 100% 5.625 3.938 N C4orf36 n/a
4 TRCN0000136940 CCTTGGGATATTGCATTGCTT pLKO.1 506 CDS 100% 3.000 2.100 N C4orf36 n/a
5 TRCN0000136705 GTTTGAGAAGACCTCTTCCAT pLKO.1 759 CDS 100% 3.000 2.100 N C4orf36 n/a
6 TRCN0000137165 GAGAAGACCTCTTCCATCTAA pLKO.1 763 CDS 100% 5.625 3.375 N C4orf36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04881 pDONR223 100% 99.7% 99.1% None 107C>A n/a
2 ccsbBroad304_04881 pLX_304 0% 99.7% 99.1% V5 107C>A n/a
3 TRCN0000475205 CTGACTGACATGGAGCGTTAGCCG pLX_317 40.4% 99.7% 99.1% V5 107C>A n/a
Download CSV