Construct: ORF TRCN0000475244
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008326.1_s317c1
- Derived from:
- ccsbBroadEn_10712
- DNA Barcode:
- ATCTCGAGAAGTACGGTCTTTTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KYAT1 (883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475244
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001122671.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
2 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352988.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
3 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352989.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
4 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352990.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
5 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352991.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
6 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352992.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
7 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352993.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
8 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_004059.5 | 55.3% | 54.9% | 687_688ins32;719_1266del |
9 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519168.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
10 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519169.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
11 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519170.2 | 55.3% | 54.9% | 687_688ins32;719_1266del |
12 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015265.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
13 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015267.1 | 55.3% | 54.9% | 687_688ins32;719_1266del |
14 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352997.1 | 51.2% | 50.8% | 1_102del;789_790ins32;821_1368del |
15 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352998.1 | 51.2% | 50.8% | 1_102del;789_790ins32;821_1368del |
16 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_011519167.3 | 49.8% | 49.4% | 1_141del;828_829ins32;860_1407del |
17 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352995.1 | 45.5% | 45% | 1_279del;966_967ins32;998_1545del |
18 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352996.1 | 45.5% | 45% | 1_279del;966_967ins32;998_1545del |
19 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001287390.2 | 45.4% | 45% | 1_282del;969_970ins32;1001_1548del |
20 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352994.1 | 45.4% | 45% | 1_282del;969_970ins32;1001_1548del |
21 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015262.1 | 45.4% | 45% | 1_282del;969_970ins32;1001_1548del |
22 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_017015260.1 | 44.3% | 43.9% | 1_321del;1008_1009ins32;1040_1587del |
23 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001122672.1 | 43.7% | 43.1% | 201_202ins150;537_538ins32;569_1116del |
24 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NM_001352999.1 | 41.9% | 41.3% | 0_1ins174;513_514ins32;545_1092del |
25 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | XM_024447709.1 | 41.9% | 41.3% | 0_1ins174;513_514ins32;545_1092del |
26 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_109829.2 | 38.3% | 1_185del;936_1957del | |
27 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_148224.1 | 27.1% | 1_185del;872_873ins32;904_2613del | |
28 | human | 883 | KYAT1 | kynurenine aminotransferase 1 | NR_148225.1 | 22.6% | 1_878del;1079_1080ins150;1479_2500del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 816
- ORF length:
- 750
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc caaacagctg caggcccgaa ggctagacgg gatcgactac aacccctggg 121 tggagtttgt gaaactggcc agtgagcatg acgtcgtgaa cttgggccag ggcttcccgg 181 atttcccacc accagacttt gccgtggaag cctttcagca cgctgtcagt ggagacttca 241 tgcttaacca gtacaccaag acatttggtt acccaccact gacgaagatc ctggcaagtt 301 tctttgggga gctgctgggt caggagatag acccgctcag gaatgtgctg gtgactgttg 361 gtggctatgg ggccctgttc acagccttcc aggccctggt ggacgaagga gacgaggtca 421 tcatcatcga accctttttt gactgctacg agcccatgac aatgatggca gggggtcgtc 481 ctgtgtttgt gtccctgaag ccgggtccca tccagaatgg agaactgggt tccagcagca 541 actggcagct ggaccccatg gagctggccg gcaaattcac atcacgcacc aaagccctGG 601 TCCTCAACAC CCCCAACAAC CCCCTGGGCA AGGTGTTCTC CAGGGAAGAG CTGGAGCTGG 661 TGGCCAGCCT TTGCCAGCAG CATGACGTGG TGTGTATCAC TGATGAAGTC TACCAGTGGA 721 TGGTCTACGA CGGGCACCAG CACATCAGCA TTGTCTCAGC AGCTGTTCTG TTCGGCCTTG 781 GGCAGCCAGC CTCCCTGGCA TGTGGGAACG GACCCTGCCC AACTTTCTTG TACAAAGTGG 841 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 901 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 961 AATCTCGAGA AGTACGGTCT TTTTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1021 aatttgtgaa agatt