Transcript: Human NM_004059.5

Homo sapiens kynurenine aminotransferase 1 (KYAT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
KYAT1 (883)
Length:
1971
CDS:
61..1329

Additional Resources:

NCBI RefSeq record:
NM_004059.5
NBCI Gene record:
KYAT1 (883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004059.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371578 ATTTCCCACCACCAGACTTTG pLKO_005 176 CDS 100% 10.800 8.640 N KYAT1 n/a
2 TRCN0000371577 GAAGCACTTTGACCACTATAT pLKO_005 1230 CDS 100% 13.200 9.240 N KYAT1 n/a
3 TRCN0000371640 AGTGGAGACTTCATGCTTAAC pLKO_005 223 CDS 100% 10.800 7.560 N KYAT1 n/a
4 TRCN0000035337 GACGAAGATCCTGGCAAGTTT pLKO.1 276 CDS 100% 5.625 3.938 N KYAT1 n/a
5 TRCN0000035336 CGTGGTGTGTATCACTGATGA pLKO.1 681 CDS 100% 4.950 3.465 N KYAT1 n/a
6 TRCN0000035335 CAAATTCACATCACGCACCAA pLKO.1 567 CDS 100% 2.640 1.848 N KYAT1 n/a
7 TRCN0000035334 GTACACCAAGACATTTGGTTA pLKO.1 246 CDS 100% 0.495 0.347 N KYAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004059.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491494 CCGTCTGTTACTCGGGCCCATTAG pLX_317 28.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_05944 pDONR223 98.6% 87.7% 87.7% None 202_351del;1266_1267insTGGCCC n/a
3 ccsbBroad304_05944 pLX_304 0% 87.7% 87.7% V5 202_351del;1266_1267insTGGCCC n/a
4 ccsbBroadEn_10712 pDONR223 100% 55.3% 54.9% None 687_688ins32;719_1266del n/a
5 ccsbBroad304_10712 pLX_304 0% 55.3% 54.9% V5 687_688ins32;719_1266del n/a
6 TRCN0000475244 ATCTCGAGAAGTACGGTCTTTTTA pLX_317 29.6% 55.3% 54.9% V5 687_688ins32;719_1266del n/a
Download CSV