Construct: ORF TRCN0000475281
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003402.1_s317c1
- Derived from:
- ccsbBroadEn_02308
- DNA Barcode:
- AACTGGGCGTGTGATTTCTTAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNK7 (10089)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475281
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10089 | KCNK7 | potassium two pore domain c... | NM_033348.2 | 100% | 100% | |
| 2 | human | 10089 | KCNK7 | potassium two pore domain c... | NM_033455.2 | 100% | 100% | |
| 3 | human | 10089 | KCNK7 | potassium two pore domain c... | NM_005714.2 | 94.5% | 94.1% | (many diffs) |
| 4 | human | 10089 | KCNK7 | potassium two pore domain c... | NM_033347.2 | 80.4% | 79.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 825
- ORF length:
- 756
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggggtcta aggccctggt cccgatacgg gctcctggtt gtggcccact 121 tgctggccct ggggcttggg gctgtggtgt tccaggccct ggaggggcct cctgcatgca 181 ggcttcaggc tgagctcagg gcagagctgg cagccttcca ggcagagcat agggcctgcc 241 tgccacccgg agctctggaa gagctgctgg gcactgccct ggccacccag gcccatgggg 301 tctccaccct gggcaacagc tcagagggca ggacctggga ccttccctca gccctgctct 361 tcgctgccag catcctcacc accacaggtt atggccacat ggccccacta tcgccaggcg 421 gaaaggcctt ctgcatggtc tatgcagccc tggggctgcc agcctcctta gctctcgtgg 481 ccaccctgcg ccattgcctg ctgcctgtgc TCAGCCGCCC ACGTGCCTGG GTAGCGGTCC 541 ACTGGCAGCT GTCACCGGCC AGGGCTGCGC TGCTGCAGGC AGTTGCACTG GGACTGCTGG 601 TGGCCAGCAG CTTTGTGCTG CTGCCAGCGC TGGTGCTGTG GGGCCTTCAG GGCGACTGCA 661 GCCTGCTGGG GGCCGTCTAC TTCTGCTTCA GCTCGCTCAG CACCATTGGC CTGGAGGACT 721 TGCTGCCCGG CCGCGGCCGC AGCCTGCACC CCGTGATTTA CCACCTGGGC CAGCTCGCAC 781 TTCTTGGTGG AGGGACCTCA CTCCAGGGCA CGGCGTGGGA GGGGTTGCCA ACTTTCTTGT 841 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 901 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 961 GAAAGGACGA AACTGGGCGT GTGATTTCTT AATCACGCGT TAAGTCgaca atcaacctct 1021 ggattacaaa atttgtgaaa gatt