Transcript: Human NM_005714.2

Homo sapiens potassium two pore domain channel subfamily K member 7 (KCNK7), transcript variant C, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
KCNK7 (10089)
Length:
1386
CDS:
29..802

Additional Resources:

NCBI RefSeq record:
NM_005714.2
NBCI Gene record:
KCNK7 (10089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430166 GTAAGTCCAGCCACCTAACAG pLKO_005 747 CDS 100% 4.950 6.930 N KCNK7 n/a
2 TRCN0000045088 TCGCACTTCTTGGTAAGTCCA pLKO.1 735 CDS 100% 2.640 3.696 N KCNK7 n/a
3 TRCN0000431749 TACTTCTGCTTCAGCTCGCTC pLKO_005 638 CDS 100% 2.160 3.024 N KCNK7 n/a
4 TRCN0000436789 AGGATGAACTGGCTCTGAGCA pLKO_005 1150 3UTR 100% 2.640 1.848 N KCNK7 n/a
5 TRCN0000413862 CTCTGGTGGCAGCGTTGAGAA pLKO_005 888 3UTR 100% 1.650 1.155 N KCNK7 n/a
6 TRCN0000045092 CGTGATTTACCACCTGGGCCA pLKO.1 712 CDS 100% 0.180 0.126 N KCNK7 n/a
7 TRCN0000045089 GCCTTCTGCATGGTCTATGCA pLKO.1 386 CDS 100% 0.300 0.180 N KCNK7 n/a
8 TRCN0000045090 GCAGCCTTCCAGGCAGAGCAT pLKO.1 170 CDS 100% 0.000 0.000 N KCNK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02308 pDONR223 100% 94.5% 94.1% None (many diffs) n/a
2 TRCN0000475281 AACTGGGCGTGTGATTTCTTAATC pLX_317 41.7% 94.5% 94.1% V5 (many diffs) n/a
Download CSV