Construct: ORF TRCN0000475338
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006705.1_s317c1
- Derived from:
- ccsbBroadEn_12598
- DNA Barcode:
- TCAATCGACACTCCCTTCGATTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GTDC1 (79712)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475338
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001284235.1 | 100% | 100% | |
2 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354356.1 | 100% | 100% | |
3 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354358.1 | 100% | 100% | |
4 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_024659.5 | 78.2% | 78.2% | 877_1119del |
5 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004944.1 | 78.2% | 78.2% | 877_1119del |
6 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004945.1 | 78.2% | 78.2% | 877_1119del |
7 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004946.1 | 78.2% | 78.2% | 877_1119del |
8 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004947.1 | 78.2% | 78.2% | 877_1119del |
9 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004948.1 | 78.2% | 78.2% | 877_1119del |
10 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001284233.2 | 77.6% | 77.6% | 877_1128del |
11 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354360.1 | 77.6% | 77.6% | 877_1128del |
12 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004942.1 | 77.6% | 77.6% | 877_1128del |
13 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004943.1 | 77.6% | 77.6% | 877_1128del |
14 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004941.1 | 76.4% | 76.4% | 1_27del;904_1146del |
15 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004940.2 | 75.8% | 75.8% | 1_27del;904_1155del |
16 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354353.1 | 72.4% | 65.2% | (many diffs) |
17 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004957.2 | 72.2% | 59.3% | (many diffs) |
18 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004956.2 | 70.2% | 57.6% | (many diffs) |
19 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004939.2 | 68.7% | 68.7% | 520_666del;1024_1275del |
20 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354352.1 | 68% | 55.1% | (many diffs) |
21 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354362.1 | 68% | 55.1% | (many diffs) |
22 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004950.2 | 68% | 55.1% | (many diffs) |
23 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004951.2 | 68% | 55.1% | (many diffs) |
24 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004954.2 | 68% | 55.1% | (many diffs) |
25 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453149.1 | 68% | 55.1% | (many diffs) |
26 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004938.1 | 67.7% | 67.7% | 1_27del;547_693del;1051_1293del |
27 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004937.2 | 67.2% | 67.2% | 1_27del;547_693del;1051_1302del |
28 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004949.2 | 66.3% | 53.8% | (many diffs) |
29 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001006636.5 | 63.7% | 63.7% | 877_1374del |
30 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001164629.4 | 63.7% | 63.7% | 877_1374del |
31 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354354.1 | 63.7% | 63.7% | 877_1374del |
32 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354361.1 | 63.7% | 63.7% | 877_1374del |
33 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004928.2 | 63.7% | 63.7% | 877_1374del |
34 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004929.2 | 63.7% | 63.7% | 877_1374del |
35 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004930.2 | 63.7% | 63.7% | 877_1374del |
36 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004934.2 | 63.7% | 63.7% | 877_1374del |
37 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004935.2 | 63.7% | 63.7% | 877_1374del |
38 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004936.2 | 63.7% | 63.7% | 877_1374del |
39 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453146.1 | 63.7% | 63.7% | 877_1374del |
40 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004926.2 | 62.5% | 62.5% | 1_27del;904_1401del |
41 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_005263774.3 | 57.5% | 57.5% | 520_666del;1024_1521del |
42 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_005263784.3 | 57.5% | 57.5% | 520_666del;1024_1521del |
43 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_011511843.3 | 57.5% | 57.5% | 520_666del;1024_1521del |
44 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_011511855.3 | 57.5% | 57.5% | 520_666del;1024_1521del |
45 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004918.2 | 57.5% | 57.5% | 520_666del;1024_1521del |
46 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004920.2 | 57.5% | 57.5% | 520_666del;1024_1521del |
47 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004921.2 | 57.5% | 57.5% | 520_666del;1024_1521del |
48 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004922.2 | 57.5% | 57.5% | 520_666del;1024_1521del |
49 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004923.2 | 57.5% | 57.5% | 520_666del;1024_1521del |
50 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453142.1 | 57.5% | 57.5% | 520_666del;1024_1521del |
51 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453143.1 | 57.5% | 57.5% | 520_666del;1024_1521del |
52 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453141.1 | 56.5% | 56.5% | 1_27del;547_693del;1051_1548del |
53 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001284238.2 | 54.9% | 51.4% | (many diffs) |
54 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453147.1 | 54.9% | 51.4% | (many diffs) |
55 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453148.1 | 54.9% | 51.4% | (many diffs) |
56 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_011511856.3 | 49.6% | 46.4% | (many diffs) |
57 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_017004925.2 | 49.6% | 46.4% | (many diffs) |
58 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453144.1 | 49.6% | 46.4% | (many diffs) |
59 | human | 79712 | GTDC1 | glycosyltransferase like do... | XM_024453145.1 | 49.6% | 46.4% | (many diffs) |
60 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001284234.2 | 35.5% | 35.5% | 0_1ins387;490_987del |
61 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354351.1 | 35.5% | 35.5% | 0_1ins387;490_987del |
62 | human | 79712 | GTDC1 | glycosyltransferase like do... | NR_148872.1 | 34.4% | 1_233del;1109_2538delinsG | |
63 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354350.1 | 29.9% | 26.6% | (many diffs) |
64 | human | 79712 | GTDC1 | glycosyltransferase like do... | NM_001354355.1 | 29.9% | 26.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tatcctcatc attgaagcat tctatggagg ctcccataaa cagctggtgg 121 atcttcttca agaagagtta ggagactgtg tcgtttatac ccttcctgca aagaaatggc 181 attggagagc ccggacatct gctttatatt tctctcagac cattcccatc agtgagcatt 241 acaggaccct ctttgcaagt tcagtgctta acctgaccga actggctgcc cttcggcctg 301 accttgggaa actgaaaaag attctgtatt ttcacgagaa ccagttgata tatcctgtca 361 agaaatgtca ggagagggat ttccaatatg gatacaacca aattctttca tgcctggtgg 421 ctgatgtggt tgtattcaac tcagttttta atatggaatc atttctcact tccatgggaa 481 aatttatgaa gctgattcct gatcacagac ccaaggatct ggaaagcatc atcagaccca 541 agtgccaagt tatttacttt cccatcaggt ttcctgatgt gagcagattc atgcccaagc 601 acaaaacaac ccatttaaag aagatgctcg gCCTTAAAGG AAATGGCGGT GCGGTTCTGT 661 CCATGGCCCT TCCTTTTCAG CCAGAGCAGA GAGATTCAGA GGATTTATTG AAGAATTTTA 721 ATTCAGAGTG TGATACACAC TGTGGCCTTG ATACTGCACG ACAAGAATAT TTGGGTAACT 781 CATTAAGACA GGAATCAGAC TTGAAAAAAT CCACCTCGTC AGATAATTCA AGCTCTCATC 841 ATGGTGAAAA TAAACAAAAT CTGACTGTTG ATCCCTGTGA CATTTTGGGT GGAGTTGATA 901 ATCAGCAAAG ACTGCTACAC ATTGTCTGGC CTCACAGGTG GTACCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGATCA ATCGACACTC CCTTCGATTC CACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t