Transcript: Human XM_005263784.3

PREDICTED: Homo sapiens glycosyltransferase like domain containing 1 (GTDC1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTDC1 (79712)
Length:
3622
CDS:
92..1615

Additional Resources:

NCBI RefSeq record:
XM_005263784.3
NBCI Gene record:
GTDC1 (79712)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418453 ACAGATTCCTAGAGACGTTAT pLKO_005 1826 3UTR 100% 10.800 15.120 N Gtdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12598 pDONR223 100% 57.5% 57.5% None 520_666del;1024_1521del n/a
2 ccsbBroad304_12598 pLX_304 0% 57.5% 57.5% V5 520_666del;1024_1521del n/a
3 TRCN0000475338 TCAATCGACACTCCCTTCGATTCC pLX_317 35.8% 57.5% 57.5% V5 520_666del;1024_1521del n/a
Download CSV