Construct: ORF TRCN0000475380
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008243.1_s317c1
- Derived from:
- ccsbBroadEn_10325
- DNA Barcode:
- GGCCCCGGATGCCGGCCGCCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPSAP52 (204010)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475380
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3921 | RPSA | ribosomal protein SA | NM_002295.6 | 61.1% | 31.9% | (many diffs) |
| 2 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355283.2 | 61.1% | 31.7% | (many diffs) |
| 3 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355287.2 | 61.1% | 31.7% | (many diffs) |
| 4 | human | 3921 | RPSA | ribosomal protein SA | NM_001304288.2 | 60.1% | 31.4% | (many diffs) |
| 5 | human | 204010 | RPSAP52 | ribosomal protein SA pseudo... | NR_026825.2 | 51.6% | 1_421del;1013_1144del | |
| 6 | human | 653162 | RPSAP9 | ribosomal protein SA pseudo... | NR_026890.1 | 37.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 657
- ORF length:
- 591
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gaagtttgct gctgccactg gagccactcc aattgctggc cacttcactc 121 ctggaacctt cctaaccaga tccaggcagc ctactgggag ccacggcttc ttgtggtttc 181 tgaccccagg gctgaccacc agtctctcac agaggcatct tgtgttaacc cacctgccat 241 tgctttatgc aacacagatt ctcctctgtg ccattggaca ttgccatcac atgcaacaac 301 aagggagctc cctcagtggg tcagatgtgg tagatgctgg cctgggaagt tctgcacatg 361 cgtggcacca tttcctgcaa cacccatggg aggtaatgtc taatctctac ttctacagag 421 atcctgaaga gactgaaaaa gaagagcagg cTGCTGCTGA AAAGGCTGTG ACCAAGAAGG 481 AATTTCAGGG TAAATGGACT GTTTCAGCTC CTGAGTTCAC TGTTACTCAG CCTGAAGTTG 541 CAGACTGGTC TGAAGGCATG CAGGTGCCCT CTGTGCCTAT TCAGCAGTTT CTACTGAAGA 601 CTGGAAGGCT CAGCCTGCCA TGGAAGACTG GTCCACAGCT CCACTGCTCA GGCCACTGCC 661 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 721 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 781 ATATATCTTG TGGAAAGGAC GAGGCCCCGG ATGCCGGCCG CCGCCAACGC GTTAAGTCga 841 caatcaacct ctggattaca aaatttgtga aagatt