Construct: ORF TRCN0000475419
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002309.1_s317c1
- Derived from:
- ccsbBroadEn_14186
- DNA Barcode:
- TGCATTTGCAAACCTTTGACACTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- KIF26B (55083)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475419
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55083 | KIF26B | kinesin family member 26B | XM_017030182.1 | 8% | 2.7% | (many diffs) |
| 2 | human | 55083 | KIF26B | kinesin family member 26B | NM_018012.4 | 7.2% | 1.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 501
- ORF length:
- 435
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gctgacgttg agcaggcagc cggcagtgag cactacgacg cctcgccctg 121 ctccccgcca ccgctctcca acatccccac cctggtgggg tcccggcacg tgggtgggct 181 ccagcagccc agagactggg cctttgtgcc cgccccctgt gccacctcca actacacagg 241 cttcgccaac aagcacggca gcaaacccag cagccttggg gtcagcaatg gggcggaaaa 301 gaagagcggg tccccaaccc accaggccaa ggtcagcctc cagatggcca ccagtccaag 361 caatgggaac atcctcaatt cggtggccat ccaggctcac cagtacctgg atggcacctg 421 gtccctgtcg agaaccaacg gGGTCACCCT GTACCCATAC CAGGACTCCG AAGCTCTTGT 481 CACACGTGGC AGGGGCCGGT TAGAAGACTC GGCGGCTGCG CCAGCGCTGA TGAGCGAGGA 541 CAGAGGAGCA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA 601 CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC 661 GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATGCA TTTGCAAACC TTTGACACTC 721 ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt