Transcript: Human NM_018012.4

Homo sapiens kinesin family member 26B (KIF26B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
KIF26B (55083)
Length:
13593
CDS:
441..6767

Additional Resources:

NCBI RefSeq record:
NM_018012.4
NBCI Gene record:
KIF26B (55083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246343 ACGAGCTGCCCAGAAGTTAAA pLKO_005 1604 CDS 100% 13.200 18.480 N KIF26B n/a
2 TRCN0000257499 GCAATGGGAACATCCTCAATT pLKO_005 1336 CDS 100% 13.200 10.560 N KIF26B n/a
3 TRCN0000246342 AGCACTTTGAGGAACCTTAAA pLKO_005 7020 3UTR 100% 13.200 9.240 N KIF26B n/a
4 TRCN0000257513 CGGCTGTGATTCACGACAAAC pLKO_005 919 CDS 100% 10.800 7.560 N KIF26B n/a
5 TRCN0000246341 TCATCCTGGCTCTCGTCAATG pLKO_005 2656 CDS 100% 10.800 6.480 N KIF26B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14186 pDONR223 100% 7.2% 1.6% None (many diffs) n/a
2 ccsbBroad304_14186 pLX_304 0% 7.2% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475419 TGCATTTGCAAACCTTTGACACTC pLX_317 23.7% 7.2% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV