Construct: ORF TRCN0000475420
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006894.1_s317c1
- Derived from:
- ccsbBroadEn_03148
- DNA Barcode:
- GCCGAATCCCAGCATATATGCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL21R (50615)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475420
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 50615 | IL21R | interleukin 21 receptor | NM_021798.4 | 100% | 100% | |
2 | human | 50615 | IL21R | interleukin 21 receptor | NM_181078.3 | 100% | 100% | |
3 | human | 50615 | IL21R | interleukin 21 receptor | XM_017023257.2 | 100% | 100% | |
4 | human | 50615 | IL21R | interleukin 21 receptor | NM_181079.5 | 96% | 96% | 1_66del |
5 | human | 50615 | IL21R | interleukin 21 receptor | XM_011545857.3 | 96% | 96% | 1_66del |
6 | human | 50615 | IL21R | interleukin 21 receptor | XM_011545858.3 | 76.9% | 68.6% | 0_1ins217;135_136ins155 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1680
- ORF length:
- 1614
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gcgtggctgg gccgccccct tgctcctgct gctgctccag ggaggctggg 121 gctgccccga cctcgtctgc tacaccgatt acctccagac ggtcatctgc atcctggaaa 181 tgtggaacct ccaccccagc acgctcaccc ttacctggca agaccagtat gaagagctga 241 aggacgaggc cacctcctgc agcctccaca ggtcggccca caatgccacg catgccacct 301 acacctgcca catggatgta ttccacttca tggccgacga cattttcagt gtcaacatca 361 cagaccagtc tggcaactac tcccaggagt gtggcagctt tctcctggct gagagcatca 421 agccggctcc ccctttcaac gtgactgtga ccttctcagg acagtataat atctcctggc 481 gctcagatta cgaagaccct gccttctaca tgctgaaggg caagcttcag tatgagctgc 541 agtacaggaa ccggggagac ccctgggctg tgagtccgag gagaaagctg atctcagtgg 601 actcaagaag tgtctccctc ctccccctgg agttccgcaa agactcgagc tatgagctgc 661 aggtgcgggc agggcccatg cctggctcct cctaccaggg gacctggagt gaatggagtg 721 acccggtcat ctttcagacc cagtcagagg agttaaagga aggctggaac cctcacctgc 781 tgcttctcct cctgcttgtc atagtcttca ttcctgcctt ctggagcctg aagacccatc 841 cattgtggag gctatggaag aagatatggg ccgtccccag ccctgagcgg ttcttcatgc 901 ccctgtacaa gggctgcagc ggagacttca agaaatgggt gggtgcaccc ttcactggct 961 ccagcctgga gctgggaccc tggagcccag aggtgccctc caccctggag gtgtacagct 1021 gccacccacc acggagcccg gccaagaggc tgcagctcac ggagctacaa gaaccagcag 1081 agctggtgga gtctgacggt gtgcccaagc ccagcttctg gccgacagcc cagaactcgg 1141 ggggctcagc ttacagtgag gagagggatc ggccatacgg cctggtgtcc attgacacag 1201 tgactgtgct agatgcagag gggccatgca cctggccctg cagctgtgag gatgacggct 1261 acccagccct ggacctggat gctggcctgg agcccagccc aggcctagag gacccactct 1321 tggatgcagg gaccacagtc ctgtcctgtg gctgtgtctc agctggcagc cctgggctag 1381 gagggcccct gggaagcctc ctggacagac taaagccacc ccttgcagat ggggaggact 1441 gggctggggg actgcccTGG GGTGGCCGGT CACCTGGAGG GGTCTCAGAG AGTGAGGCGG 1501 GCTCACCCCT GGCCGGCCTG GATATGGACA CGTTTGACAG TGGCTTTGTG GGCTCTGACT 1561 GCAGCAGCCC TGTGGAGTGT GACTTCACCA GCCCCGGGGA CGAAGGACCC CCCCGGAGCT 1621 ACCTCCGCCA GTGGGTGGTC ATTCCTCCGC CACTTTCGAG CCCTGGACCC CAGGCCAGCT 1681 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1741 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1801 TTTATATATC TTGTGGAAAG GACGAGCCGA ATCCCAGCAT ATATGCCCAA CGCGTTAAGT 1861 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt