Transcript: Human NM_181078.3

Homo sapiens interleukin 21 receptor (IL21R), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
IL21R (50615)
Length:
4837
CDS:
462..2078

Additional Resources:

NCBI RefSeq record:
NM_181078.3
NBCI Gene record:
IL21R (50615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359412 ACTTCATGGCCGACGACATTT pLKO_005 721 CDS 100% 13.200 18.480 N IL21R n/a
2 TRCN0000359486 CCTCGTCTGCTACACCGATTA pLKO_005 527 CDS 100% 10.800 15.120 N IL21R n/a
3 TRCN0000058168 GACACGTTTGACAGTGGCTTT pLKO.1 1923 CDS 100% 4.050 5.670 N IL21R n/a
4 TRCN0000359411 GACCCAGTCAGAGGAGTTAAA pLKO_005 1133 CDS 100% 13.200 10.560 N IL21R n/a
5 TRCN0000359487 AGCTGCAAGAAGTCCATATTG pLKO_005 2570 3UTR 100% 13.200 9.240 N IL21R n/a
6 TRCN0000058169 CATGGATGTATTCCACTTCAT pLKO.1 707 CDS 100% 4.950 3.465 N IL21R n/a
7 TRCN0000058170 CCTCCTGCTTGTCATAGTCTT pLKO.1 1184 CDS 100% 4.950 3.465 N IL21R n/a
8 TRCN0000058171 CCCTGCCTTCTACATGCTGAA pLKO.1 893 CDS 100% 4.050 2.835 N IL21R n/a
9 TRCN0000058172 CGGAGACTTCAAGAAATGGGT pLKO.1 1316 CDS 100% 0.750 0.525 N IL21R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03148 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03148 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475420 GCCGAATCCCAGCATATATGCCCA pLX_317 14.2% 100% 100% V5 n/a
4 TRCN0000488168 CGTATCTCATGTAAAACCTCCAAC pLX_317 16.7% 99.8% 100% V5 (not translated due to prior stop codon) 6G>A;21C>T;1605C>A n/a
Download CSV