Construct: ORF TRCN0000475535
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000182.1_s317c1
- Derived from:
- ccsbBroadEn_12814
- DNA Barcode:
- ACGATCAACCTGCGTTTTCCCGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COA8 (84334)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475535
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NM_001370595.1 | 99.8% | 99.4% | 40C>G |
| 2 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NM_001302652.2 | 94.6% | 82.7% | 40C>G;474_475insAG;549_550ins28 |
| 3 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NM_001302654.2 | 67.7% | 66.3% | (many diffs) |
| 4 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NM_001302653.2 | 66.2% | 57.5% | 40C>G;386_473del;531_532ins136 |
| 5 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NR_126432.2 | 41.5% | (many diffs) | |
| 6 | human | 84334 | COA8 | cytochrome c oxidase assemb... | NR_126431.2 | 41.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 645
- ORF length:
- 579
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggtcttgcgg gcggggaaga agacctttct ccccgctctc tgccgcgcct 121 tcgcctgccg cggctgtcaa ctcgctccgg agcgcggcgc cgagcgcagg gatacggcgc 181 ccagcggggt ctcaagattc tgccctccaa gaaagtcttg ccatgattgg ataggacccc 241 cagataaata ttcaaacctt cgacctgttc acttttacat acctgaaaat gaatctccat 301 tggaacaaaa gcttagaaaa ttaagacaag aaacacaaga atggaatCAA CAGTTCTGGG 361 CAAACCAGAA TTTGACTTTT AGTAAGGAAA AAGAAGAATT TATTCACTCA AGACTAAAAA 421 CTAAAGGCCT GGGCCTGAGA ACTGAATCAG GTCAGAAAGC AACATTGAAT GCAGAAGAAA 481 TGGCGGACTT CTACAAGGAA TTTTTAAGTA AAAATTTTCA GAAGCACATG TATTATAACA 541 GAGATTGGTA CAAGCGCAAT TTTGCCATCA CCTTCTTCAT GGGAAAAGTG GCCCTGGAAA 601 GGATTTGGAA CAAGCTTAAA CAGAAACAAA AGAAGAGGAG CAACTACCCA ACTTTCTTGT 661 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 721 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 781 GAAAGGACGA ACGATCAACC TGCGTTTTCC CGCAACGCGT TAAGTCgaca atcaacctct 841 ggattacaaa atttgtgaaa gatt