Transcript: Human NM_001370595.1

Homo sapiens cytochrome c oxidase assembly factor 8 (COA8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
COA8 (84334)
Length:
3552
CDS:
43..624

Additional Resources:

NCBI RefSeq record:
NM_001370595.1
NBCI Gene record:
COA8 (84334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365159 AGATTGGTACAAGCGCAATTT pLKO_005 519 CDS 100% 13.200 18.480 N COA8 n/a
2 TRCN0000365158 CGTTTCCTGTGTTTCGAATTA pLKO_005 870 3UTR 100% 13.200 18.480 N COA8 n/a
3 TRCN0000370276 GTCACGTACGTGGTGTGAAAT pLKO_005 828 3UTR 100% 13.200 18.480 N COA8 n/a
4 TRCN0000370274 ATGAATCTCCATTGGAACAAA pLKO_005 266 CDS 100% 5.625 7.875 N COA8 n/a
5 TRCN0000370220 TTTCAGAAGCACATGTATTAT pLKO_005 493 CDS 100% 15.000 10.500 N COA8 n/a
6 TRCN0000365171 AGGATTTGGAACAAGCTTAAA pLKO_005 577 CDS 100% 13.200 9.240 N COA8 n/a
7 TRCN0000172513 CAAGATTCTGCCCTCCAAGAA pLKO.1 170 CDS 100% 4.950 3.465 N COA8 n/a
8 TRCN0000167894 CCAAGAAAGTCTTGCCATGAT pLKO.1 184 CDS 100% 4.950 3.465 N COA8 n/a
9 TRCN0000377529 AGCAACTAGGAGTCCACTCTG pLKO_005 616 CDS 100% 4.050 2.835 N COA8 n/a
10 TRCN0000167141 CCCAGATAAATATTCAAACCT pLKO.1 216 CDS 100% 3.000 2.100 N COA8 n/a
11 TRCN0000166911 GAAAGCAACATTGAATGCAGA pLKO.1 432 CDS 100% 2.640 1.848 N COA8 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3158 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 943 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 943 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2250 3UTR 100% 4.950 2.475 Y NPHS1 n/a
16 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2593 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2593 3UTR 100% 4.050 2.025 Y ORAI2 n/a
18 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2593 3UTR 100% 4.050 2.025 Y P3H4 n/a
19 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2720 3UTR 100% 10.800 5.400 Y SMIM11A n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 941 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 941 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 941 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12814 pDONR223 100% 99.8% 99.4% None 40C>G n/a
2 ccsbBroad304_12814 pLX_304 0% 99.8% 99.4% V5 40C>G n/a
3 TRCN0000475535 ACGATCAACCTGCGTTTTCCCGCA pLX_317 51.4% 99.8% 99.4% V5 40C>G n/a
Download CSV