Construct: ORF TRCN0000475553
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003891.1_s317c1
- Derived from:
- ccsbBroadEn_05642
- DNA Barcode:
- TTTTTCAAACCGGACTCAGACGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IQCF3 (401067)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475553
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 401067 | IQCF3 | IQ motif containing F3 | NM_001085479.3 | 100% | 100% | |
| 2 | human | 401067 | IQCF3 | IQ motif containing F3 | NM_001207023.2 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 531
- ORF length:
- 462
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggcagtaaa tgctgtaaag gtggtccaga tgaagatgca gtagaaagac 121 agaggcggca gaagttgctt cttgcacaac tgcatcacag aaaaagggtg aaggcagctg 181 ggcagatcca ggcctggtgg cgtggggtcc tggtgcgcag gaccctgctg gttgctgccc 241 tcagggcctg gatgattcag tgctggtgga ggacgttggt gcagagacgg atccgtcagc 301 ggcggcaggc cctgttgagg gtcTACGTCA TCCAGGAGCA GGCGACGGTC AAGCTCCAGT 361 CCTGCATCCG CATGTGGCAG TGCCGGCAAT GTTACCGCCA AATGTGCAAT GCTCTCTGCT 421 TGTTCCAGGT CCCAGAGAGC AGCCTTGCCT TCCAGACTGA TGGCTTTTTA CAGGTCCAAT 481 ATGCAATCCC TTCAAAGCAG CCAGAGTTCC ACATTGAAAT CCTATCAATC TTGCCAACTT 541 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 601 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 661 CTTGTGGAAA GGACGATTTT TCAAACCGGA CTCAGACGAC ACGCGTTAAG TCgacaatca 721 acctctggat tacaaaattt gtgaaagatt