Transcript: Human NM_001207023.2

Homo sapiens IQ motif containing F3 (IQCF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
IQCF3 (401067)
Length:
1266
CDS:
747..1211

Additional Resources:

NCBI RefSeq record:
NM_001207023.2
NBCI Gene record:
IQCF3 (401067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246320 CCGGCAATGTTACCGCCAAAT pLKO_005 1061 CDS 100% 10.800 15.120 N IQCF3 n/a
2 TRCN0000246318 TGCAATGCTCTCTGCTTGTTC pLKO_005 1083 CDS 100% 4.950 3.465 N IQCF3 n/a
3 TRCN0000246319 TTGCACAACTGCATCACAGAA pLKO_005 820 CDS 100% 4.950 3.465 N IQCF3 n/a
4 TRCN0000257512 TGTTGAGGGTCTACGTCATCC pLKO_005 991 CDS 100% 4.050 2.835 N IQCF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05642 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05642 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475553 TTTTTCAAACCGGACTCAGACGAC pLX_317 44.9% 100% 100% V5 n/a
Download CSV