Construct: ORF TRCN0000475573
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001290.1_s317c1
- Derived from:
- ccsbBroadEn_12456
- DNA Barcode:
- CACTGCAGTGCACTCTTACCCGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA1 (100505741)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475573
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542516.1 | 100% | 100% | |
| 2 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542517.1 | 100% | 100% | |
| 3 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542519.2 | 91.7% | 86.5% | (many diffs) |
| 4 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542515.2 | 91.4% | 91% | (many diffs) |
| 5 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542522.2 | 87.1% | 85.5% | (many diffs) |
| 6 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_947545.1 | 68.4% | (many diffs) | |
| 7 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542514.2 | 68.1% | 59.4% | 724_727delAGTC;857_1251del |
| 8 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_024446289.1 | 61.8% | 54% | 724_727delAGTC;857_1377del |
| 9 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | NM_001310156.2 | 57% | 49.3% | 0_1ins66;658_661delAGTC;791_1311del |
| 10 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_002956255.1 | 32.7% | (many diffs) | |
| 11 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_002956254.1 | 32.7% | (many diffs) | |
| 12 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_006502095.3 | 67.8% | 58.5% | (many diffs) |
| 13 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_011240229.2 | 44.7% | 37.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 921
- ORF length:
- 852
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagaaagat aaaaaaagaa acaaaattcc aattgataat tatcccattc 121 agacattagt gaatatgtca ctcaatccaa gtcgaccttc ctcatcagag ttggtggaac 181 ttcatgtttt ttatgtccct gaaggatcat ggaactataa gctaaatacc atttcaacag 241 aagttgttaa caaattcatt tcagctggat ttctaagagt atctcctcaa cttactttac 301 gagccctgag ggagcgtctt ggtgagttcc tgggtgaaga tgctattgca gaaaaatttt 361 tatttctgaa atgcattgga aataatttag ctgtggtgaa ggaaaagcaa gaatcagaac 421 tgaaactcaa atcatttgct cctccatatg ctcttcaacc agaattatat ttgcttcctg 481 taatggacca tttaggaaat gtttattcac catcaacagt tattttagat gagcggcaga 541 ctaataatgg tgttaatgag gctgatggaa caatccacag accaattagt gtaactttgt 601 tcaaggagga acttggaaga gatcccagtt tgttagaaaa cactttgaaa gagcttccta 661 acaagaatca ggaagaagct gggggaaaag ccactgcaga aaaaagccaa attgcaaaaa 721 atcaaattgg aaatTCTGAG TTGCCAGGAT CATTGGAAGA TTCAAATAAT GATTGCTTTG 781 GCACTAAAAA AAGTGTCTTT GGGAAAATGA AGATGATACA GCTATCAGTA GAAGACAGGA 841 CAATCAGACA GCTGAAAAAG AGTACATCAC CCTACCAGAT CACCCTTCAC TTCCTTGTCA 901 ACCTGTTCTT TCTTCAGGAA TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACACT GCAGTGCACT 1081 CTTACCCGAA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt