Transcript: Human XM_011542522.2

PREDICTED: Homo sapiens spermatogenesis associated 1 (SPATA1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA1 (100505741)
Length:
1094
CDS:
190..942

Additional Resources:

NCBI RefSeq record:
XM_011542522.2
NBCI Gene record:
SPATA1 (100505741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136814 CCTGAAGGATCATGGAACTAT pLKO.1 319 CDS 100% 5.625 3.938 N SPATA1 n/a
2 TRCN0000134784 CCTAACAAGAATCAGGAAGAA pLKO.1 778 CDS 100% 4.950 3.465 N SPATA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12456 pDONR223 100% 87.1% 85.5% None (many diffs) n/a
2 ccsbBroad304_12456 pLX_304 0% 87.1% 85.5% V5 (many diffs) n/a
3 TRCN0000475573 CACTGCAGTGCACTCTTACCCGAA pLX_317 22.5% 87.1% 85.5% V5 (many diffs) n/a
4 ccsbBroadEn_12455 pDONR223 100% 83.6% 82.4% None (many diffs) n/a
5 ccsbBroad304_12455 pLX_304 0% 83.6% 82.4% V5 (many diffs) n/a
6 TRCN0000479631 TATATCCGGCGAGCAATGCCGGCC pLX_317 37% 83.6% 82.4% V5 (many diffs) n/a
Download CSV