Construct: ORF TRCN0000475625
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017607.1_s317c1
- Derived from:
- ccsbBroadEn_03036
- DNA Barcode:
- TGCACCTTGCTAGATGATAACTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNMB4 (27345)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475625
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27345 | KCNMB4 | potassium calcium-activated... | NM_014505.6 | 100% | 100% | |
| 2 | human | 27345 | KCNMB4 | potassium calcium-activated... | XM_011538188.2 | 79.4% | 76% | (many diffs) |
| 3 | human | 27345 | KCNMB4 | potassium calcium-activated... | XR_245917.4 | 47.9% | 1_512del;977_1119del;1286_1314del | |
| 4 | mouse | 58802 | Kcnmb4 | potassium large conductance... | NM_021452.1 | 91.5% | 93.8% | (many diffs) |
| 5 | mouse | 58802 | Kcnmb4 | potassium large conductance... | XM_006513911.3 | 65.6% | 47.4% | (many diffs) |
| 6 | mouse | 58802 | Kcnmb4 | potassium large conductance... | XM_017314034.1 | 54.8% | 43.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 696
- ORF length:
- 630
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaagctccgg gtggcttacg agtacacgga agccgaggac aagagcatcc 121 ggctcggctt gtttctcatc atctccggcg tcgtgtcgct cttcatcttc ggcttctgct 181 ggctgagtcc cgcgctgcag gatctgcaag ccacggaggc caattgcacg gtgctgtcgg 241 tgcagcagat cggcgaggtg ttcgagtgca ccttcacctg tggcgccgac tgcaggggca 301 cctcgcagta cccctgcgtc caggtctacg tgaacaactc tgagtccaac tctagggcgc 361 tgctgcacag cgacgagcac cagctcctga ccaaccccaa gtgctcctat atccctccct 421 gtaagagaga aaatcagaag aatttggaaa gtgtcatgaa ttggcaacag tactggaaag 481 atgagattgg ttcccagcca tttacttgct attttaatca acatcaaaga ccagatgatg 541 tgcttcTGCA TCGCACTCAT GATGAGATTG TCCTCCTGCA TTGCTTCCTC TGGCCCCTGG 601 TGACATTTGT GGTGGGCGTT CTCATTGTGG TCCTGACCAT CTGTGCCAAG AGCTTGGCGG 661 TCAAGGCGGA AGCCATGAAG AAGCGCAAGT TCTCTTACCC AACTTTCTTG TACAAAGTGG 721 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 781 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 841 ATGCACCTTG CTAGATGATA ACTATACGCG TTAAGTCgac aatcaacctc tggattacaa 901 aatttgtgaa agatt