Transcript: Mouse XM_006513911.3

PREDICTED: Mus musculus potassium large conductance calcium-activated channel, subfamily M, beta member 4 (Kcnmb4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnmb4 (58802)
Length:
1753
CDS:
22..531

Additional Resources:

NCBI RefSeq record:
XM_006513911.3
NBCI Gene record:
Kcnmb4 (58802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068655 CGTGAACAACTCCGAGTCCAA pLKO.1 285 CDS 100% 2.640 1.848 N Kcnmb4 n/a
2 TRCN0000068657 CCCGCCTTGCAGGATCTGCAA pLKO.1 145 CDS 100% 0.000 0.000 N Kcnmb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03036 pDONR223 100% 65.6% 47.4% None (many diffs) n/a
2 ccsbBroad304_03036 pLX_304 0% 65.6% 47.4% V5 (many diffs) n/a
3 TRCN0000475625 TGCACCTTGCTAGATGATAACTAT pLX_317 24.6% 65.6% 47.4% V5 (many diffs) n/a
Download CSV