Construct: ORF TRCN0000475633
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002390.1_s317c1
- Derived from:
- ccsbBroadEn_14467
- DNA Barcode:
- ACGATAAAACACCACTTTTTCGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PPIL6 (285755)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475633
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | NM_173672.5 | 99.8% | 1.6% | 5_6insA |
| 2 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | NM_001111298.2 | 92.1% | 1.4% | 5_6insA;687_764del |
| 3 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | NM_001286360.1 | 89.6% | 1.4% | 5_6insA;134_135ins96 |
| 4 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_011535765.3 | 82.7% | 1.3% | 5_6insA;134_135ins96;591_668del |
| 5 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_011535767.3 | 82.2% | 1.7% | (many diffs) |
| 6 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_011535766.3 | 81.6% | 1.7% | (many diffs) |
| 7 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_011535769.2 | 77.9% | 1.9% | (many diffs) |
| 8 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_017010774.1 | 73.9% | 2.1% | (many diffs) |
| 9 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | XM_024446407.1 | 72.2% | 1.6% | (many diffs) |
| 10 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | NM_001286361.1 | 63.7% | 2% | (many diffs) |
| 11 | human | 285755 | PPIL6 | peptidylprolyl isomerase li... | NR_104429.1 | 21.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 102
- ORF length:
- 36
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aaaggccgca gccgtgcggg cccccgcacg ctaggtgcgg ctcgccgtcg 121 ctgccggagc ggccgctgca ggtgaaggtg gtggggctct tcagctgccc caactttcag 181 attgcgaaga gcgccgctga gaatctgaag aataatcatc catccaaatt tgaagatcct 241 atattagttc ctcttcaaga atttgcatgg catcaatatc tacaggagaa aaaaagggaa 301 ctcaaaaatg aaacctggga atattcttcc tctgtgattt cttttgttaa tggtcagttt 361 ctgggtgatg cattggatct gcagaaatgg gcccacgagg tgtgggatat agttgacatt 421 aaaccctctg cactttatga cgcactcact gaggattttt ccgctaagtt cttaagagac 481 accaagcatg atttcgtgtt tttggacatt tgtattgatt cttctccaat tggaagattg 541 atttttgagc tatactgtga tgtgtgtccc aaaacatgta aaaattttca ggtcttgtgc 601 acaggaaaag cagggttttc tcaacgtggc ataagactac attacaaaaa ttccattttt 661 catcgaatag tacagaatgg ctGGATACAA GGAGGGGATA TAGTGTATGG AAAAGGAGAT 721 AATGGAGAGT CGATTTATGG TCCAACATTT GAAGATGAAA ACTTTTCAGT TCCTCATAAT 781 AAAAGAGGAG TACTTGGAAT GGCCAACAAA GGCCGTCACA GCAACGGGTC ACAATTCTAT 841 ATCACACTGC AAGCAACTCC TTATCTAGAT AGAAAATTTG TGGCTTTTGG GCAACTGATT 901 GAAGGAACAG AAGTGCTTAA ACAACTAGAA TTAGTTCCAA CACAGAATGA AAGACCAATA 961 CATATGTGTA GAATTACTGA CAGTGGAGAT CCTTATGCTT GCCCAACTTT CTTGTACAAA 1021 GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA 1081 TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG 1141 GACGAACGAT AAAACACCAC TTTTTCGAAA CGCGTTAAGT Cgacaatcaa cctctggatt 1201 acaaaatttg tgaaagatt