Transcript: Human XM_011535767.3

PREDICTED: Homo sapiens peptidylprolyl isomerase like 6 (PPIL6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPIL6 (285755)
Length:
1919
CDS:
50..889

Additional Resources:

NCBI RefSeq record:
XM_011535767.3
NBCI Gene record:
PPIL6 (285755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535767.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049453 CCGCTGAGAATCTGAAGAATA pLKO.1 177 CDS 100% 13.200 9.240 N PPIL6 n/a
2 TRCN0000435557 GAATTTGCATGGCATCAATAT pLKO_005 242 CDS 100% 13.200 9.240 N PPIL6 n/a
3 TRCN0000049457 GTCGATTTATGGTCCAACATT pLKO.1 712 CDS 100% 5.625 3.938 N PPIL6 n/a
4 TRCN0000049455 GTGTGGGATATAGTTGACATT pLKO.1 383 CDS 100% 4.950 3.465 N PPIL6 n/a
5 TRCN0000049456 GATCCTATATTAGTTCCTCTT pLKO.1 218 CDS 100% 4.050 2.835 N PPIL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535767.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14467 pDONR223 100% 82.2% 1.7% None (many diffs) n/a
2 ccsbBroad304_14467 pLX_304 0% 82.2% 1.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475633 ACGATAAAACACCACTTTTTCGAA pLX_317 34.3% 82.2% 1.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV