Construct: ORF TRCN0000475672
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017150.1_s317c1
- Derived from:
- ccsbBroadEn_01954
- DNA Barcode:
- TCCGTTATAGTGTCTGAGTTCGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDC14A (8556)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475672
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8556 | CDC14A | cell division cycle 14A | NM_033313.2 | 100% | 100% | |
2 | human | 8556 | CDC14A | cell division cycle 14A | XM_017002647.1 | 77.4% | 77.5% | 1139delA;1142_1143insGTTTTCC;1144_1467del |
3 | human | 8556 | CDC14A | cell division cycle 14A | XM_017002646.1 | 74.7% | 72.8% | (many diffs) |
4 | human | 8556 | CDC14A | cell division cycle 14A | NM_003672.4 | 63.8% | 63.8% | 1139delA;1142_1143insGTTTTCC;1144_1782del |
5 | human | 8556 | CDC14A | cell division cycle 14A | NM_001319210.2 | 62.1% | 62.1% | 1139delA;1142_1143insGTTTTCC;1144_1830del |
6 | human | 8556 | CDC14A | cell division cycle 14A | XM_005271296.3 | 61.7% | 60.2% | (many diffs) |
7 | human | 8556 | CDC14A | cell division cycle 14A | NM_033312.2 | 60.8% | 60.8% | 1139delA;1142_1143insGTTTTCC;1144_1869del |
8 | human | 8556 | CDC14A | cell division cycle 14A | XM_011542340.2 | 60.1% | 58.6% | (many diffs) |
9 | human | 8556 | CDC14A | cell division cycle 14A | XM_005271294.3 | 58.9% | 57.4% | (many diffs) |
10 | human | 8556 | CDC14A | cell division cycle 14A | XM_011542341.3 | 55.7% | 53.7% | (many diffs) |
11 | human | 8556 | CDC14A | cell division cycle 14A | XM_024450503.1 | 52.6% | 52.6% | (many diffs) |
12 | human | 8556 | CDC14A | cell division cycle 14A | NM_001319211.1 | 51.5% | 51.5% | (many diffs) |
13 | human | 8556 | CDC14A | cell division cycle 14A | XM_011542345.3 | 40.3% | 39.9% | (many diffs) |
14 | human | 8556 | CDC14A | cell division cycle 14A | XR_002957887.1 | 35.2% | (many diffs) | |
15 | human | 8556 | CDC14A | cell division cycle 14A | XR_002957888.1 | 34.1% | (many diffs) | |
16 | human | 8556 | CDC14A | cell division cycle 14A | NM_001319212.1 | 14% | 13.8% | (many diffs) |
17 | human | 8556 | CDC14A | cell division cycle 14A | XM_024450504.1 | 14% | 13.8% | (many diffs) |
18 | human | 8556 | CDC14A | cell division cycle 14A | XM_024450505.1 | 14% | 13.8% | (many diffs) |
19 | human | 8556 | CDC14A | cell division cycle 14A | XM_024450506.1 | 14% | 13.8% | (many diffs) |
20 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | NM_001080818.2 | 57% | 60% | (many diffs) |
21 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | XM_006501419.1 | 54.4% | 57.2% | (many diffs) |
22 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | NM_001173553.1 | 49.7% | 52% | (many diffs) |
23 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | XM_006501420.2 | 45.5% | 48.4% | (many diffs) |
24 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | XM_011240108.2 | 45.5% | 48.4% | (many diffs) |
25 | mouse | 229776 | Cdc14a | CDC14 cell division cycle 14A | XM_011240109.2 | 45.5% | 48.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1218
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcagcggag tcaggggaac taatcggggc ttgtgagttc atgaaagatc 121 ggttatattt tgctacttta aggaatagac caaaaagcac agtaaatacc cactatttct 181 ccatcgatga ggagctggtc tatgaaaatt tctatgcaga ttttggaccg ctgaacttgg 241 caatggtgta cagatattgc tgcaaactaa acaagaaact aaaatcatac agtttgtcaa 301 gaaagaaaat agtgcactac acctgttttg accaacggaa aagagcaaat gcagcatttt 361 tgataggtgc ctatgcagta atctatttaa agaagacacc agaagaagcc tacagagcac 421 tcctgtctgg ctcaaacccc ccctatcttc cattcaggga tgcttccttt ggaaattgca 481 cttacaatct caccattctc gactgtttgc agggaatcag aaagggatta caacatggat 541 tttttgactt tgagacattt gatgtggatg aatatgaaca ttatgagcga gttgaaaatg 601 gtgacttcaa ctggattgtt ccaggaaaat ttttagcatt tagtggacca catcctaaaa 661 gcaaaattga gaatggttat cctcttcacg cccctgaagc ctactttcct tatttcaaaa 721 agcataatgt gactgcagtt gtgaggctaa acaaaaagat ttatgaggca aagcgcttca 781 cagacgctgg cttcgagcac tatgacctct tcttcataga tggcagcaca cccagtgaca 841 acatcgtgcg aaggttcctg aacatctgtg agaacaccga aggggccatc gccgttcact 901 gcaaagctgg tcttGGAAGA ACAGGGACAT TGATAGCCTG TTATGTAATG AAACACTACA 961 GGTTTACACA TGCTGAAATA ATTGCTTGGA TTAGAATATG CCGGCCAGGC TCTATTATAG 1021 GACCCCAGCA GCACTTCCTG GAAGAAAAAC AAGCATCGTT GTGGGTCCAA GGAGACATTT 1081 TCCGATCCAA ACTGAAAAAT CGACCATCCA GTGAAGGAAG TATTAATAAA ATTCTTTCTG 1141 GCCTAGATGA TATGTCTATT GGTGGAAATC TTTCAAAAAC ACAAAACATG GAACGATTTG 1201 GAGAGGTAAG TTTTCCCTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1261 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1321 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATCCGTTA TAGTGTCTGA 1381 GTTCGCCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt