Transcript: Human XM_011542345.3

PREDICTED: Homo sapiens cell division cycle 14A (CDC14A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC14A (8556)
Length:
1828
CDS:
264..1751

Additional Resources:

NCBI RefSeq record:
XM_011542345.3
NBCI Gene record:
CDC14A (8556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380554 GGCCTAGATGATATGTCTATT pLKO_005 951 CDS 100% 13.200 18.480 N CDC14A n/a
2 TRCN0000002979 TGGAACGATTTGGAGAGGATA pLKO.1 1000 CDS 100% 4.950 6.930 N CDC14A n/a
3 TRCN0000002980 CCAGCCAACTACCAGAAATTA pLKO.1 1442 CDS 100% 15.000 10.500 N CDC14A n/a
4 TRCN0000314593 CCAGCCAACTACCAGAAATTA pLKO_005 1442 CDS 100% 15.000 10.500 N CDC14A n/a
5 TRCN0000002981 CCAGTGAAGGAAGTATTAATA pLKO.1 919 CDS 100% 15.000 10.500 N CDC14A n/a
6 TRCN0000314533 CCAGTGAAGGAAGTATTAATA pLKO_005 919 CDS 100% 15.000 10.500 N CDC14A n/a
7 TRCN0000381797 AGATTCCTGAGCCGTTCTATC pLKO_005 1611 CDS 100% 10.800 7.560 N CDC14A n/a
8 TRCN0000002978 TCTCACCATTCTCGACTGTTT pLKO.1 299 CDS 100% 4.950 3.465 N CDC14A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01954 pDONR223 100% 40.3% 39.9% None (many diffs) n/a
2 ccsbBroad304_01954 pLX_304 0% 40.3% 39.9% V5 (many diffs) n/a
3 TRCN0000475672 TCCGTTATAGTGTCTGAGTTCGCC pLX_317 26.7% 40.3% 39.9% V5 (many diffs) n/a
Download CSV