Construct: ORF TRCN0000475723
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014373.1_s317c1
- Derived from:
- ccsbBroadEn_09663
- DNA Barcode:
- CTCAGAAACACCATATCTTCAGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CFAP57 (149465)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475723
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 149465 | CFAP57 | cilia and flagella associat... | NM_001167965.1 | 99.9% | 100% | 1809G>A |
| 2 | human | 149465 | CFAP57 | cilia and flagella associat... | NM_152498.3 | 99.9% | 100% | 1809G>A |
| 3 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540800.2 | 63.3% | 58.4% | (many diffs) |
| 4 | human | 149465 | CFAP57 | cilia and flagella associat... | XR_001736994.2 | 63.3% | (many diffs) | |
| 5 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540799.1 | 54.9% | 47.2% | (many diffs) |
| 6 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_005270520.2 | 53.8% | 49.9% | (many diffs) |
| 7 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540793.1 | 53.8% | 49.9% | (many diffs) |
| 8 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540794.1 | 53.8% | 49.9% | (many diffs) |
| 9 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540795.3 | 53.8% | 49.9% | (many diffs) |
| 10 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_017000421.1 | 53.7% | 50.4% | (many diffs) |
| 11 | human | 149465 | CFAP57 | cilia and flagella associat... | NM_001195831.3 | 52.4% | 48.7% | (many diffs) |
| 12 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_017000422.2 | 52.4% | 48.7% | (many diffs) |
| 13 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540797.2 | 51% | 45.9% | (many diffs) |
| 14 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_006710383.1 | 49.3% | 45.6% | (many diffs) |
| 15 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540796.1 | 49.3% | 45.6% | (many diffs) |
| 16 | human | 149465 | CFAP57 | cilia and flagella associat... | XM_011540798.1 | 48.2% | 44.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2163
- ORF length:
- 2094
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcagccgtg gtagctcaga cgctgcatgt ttttggtctt cgatcccacg 121 tggccaacaa tatcttctac ttcgatgaac agatcattat atttccttca ggaaatcact 181 gtgtgaagta caatgtggat cagaaatggc aaaaattcat tccaggctca gagaagagtc 241 agggcatgtt ggccttgtcc atcagtccca atcggcggta cctcgctatc tctgagactg 301 tgcaagaaaa acctgccatc accatttatg aattgtcatc catcccttgc cggaagcgca 361 aagttcttaa taattttgac ttccaagttc agaaatttat tagcatggct ttttctccag 421 actccaaata cctattggct cagacgtcac ctccagagtc aaatcttgtc tactggctgt 481 gggaaaaaca gaaagtaatg gccattgtta gaatcgacac tcagaacaac cctgtctacc 541 aggtgagctt cagtccacag gataacactc aggtgtgtgt cactggaaat gggatgttta 601 agcttctccg ttttgctgag ggaaccctga agcaaaccag ctttcagagg ggagaacccc 661 aaaactatct agctcacacc tgggtggctg atgacaagat tgtcgttggc actgacacag 721 gcaaactctt cctctttgaa tctggagatc agcgttggga gaccagcata atggtcaagg 781 aacctaccaa tggctcaaag agcctggatg tcattcagga atcagagagc ctgattgaat 841 ttccaccagt cagttctcca ctcccttcct atgaacagat ggtggcggcc agtagccata 901 gccagatgtc catgccccag gtgtttgcca ttgcagccta ttcaaaggga tttgcctgtt 961 ctgctgggcc agggagagtt ctgctgtttg agaagatgga agaaaaggat ttttaccgtg 1021 agagcagaga aatcaggatt cctgtggacc cgcagagcaa tgatccaagt cagtctgaca 1081 aacaggacgt tctctgcctg tgcttcagcc cctcagagga aactctggtt gccagcacca 1141 gtaagaacca actctacagc atcaccatgt ccctgacaga gatcagcaag ggggagcctg 1201 ctcactttga gtatttgatg tatccattgc actcagcacc catcaccggt ctagctacct 1261 gcatccgcaa accccttata gccacctgtt ctctggatcg atccatccgc ctttggaatt 1321 atgaaacaaa caccctggaa ctatttaagg aataccaaga agaggcatat tccatcagcc 1381 ttcatccatc tggacacttc attgtagtag ggtttgctga caaactacgc ctcatgaatc 1441 tactcattga tgatatacgt tctttcaaag aatactctgt tagaggatgc ggagagtgtt 1501 cctttagcaa tggaggtcac ctgtttgctg cagtcaatgg aaatgtgatt cacgtttaca 1561 ccaccacgag cctagagaac atctcaagcc tgaaaggaca cacagggaag attcgctcaa 1621 ttgtgtggaa tgcagatgat agcaaactga tttctggtgg cacagatggt gctgtgtatg 1681 aatggaatct gtccacagga aagagagaga cagaatgcgt gctcaagtct tgcagctaca 1741 actgtgttac tgtctccccc gatgccaaaa ttatctttgc tgttggatca gaccacaccc 1801 tcaaggagat tgcagattcc ttgatccTTC GAGAGATATC GGCGTTTGAT GTCACCTACA 1861 CCGCCATTGT CATCTCACAT TCTGGACGCA TGATGTTTGT GGGCACCTCG GTGGGAACCA 1921 TTCGTGCCAT GAAGTACCCT CTGCCTCTGC AGAAGGAATT CAATGAGTAC CAGGCCCATG 1981 CCGGTCCTAT CACCAAGGTG AGCAGGGCCC TCTCCCCAGG AACCCAGTCC CACACCTGCC 2041 TGCTACGTGC CTTGTTCATC CCTTCAACCT CCCAATGTCT TTTCTCTCTC CTTCTTCTCT 2101 CTTATTTATT CATCCATCAT TCATTGAATC ACCATCTATT GACTATGAAT ATACTCTTTG 2161 TTTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 2221 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 2281 GGCTTTATAT ATCTTGTGGA AAGGACGACT CAGAAACACC ATATCTTCAG TAACGCGTTA 2341 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt